Добавил:
Sekretar
kiopkiopkiop18@yandex.ru
t.me/Prokururor I Вовсе не секретарь, но почту проверяю
Опубликованный материал нарушает ваши авторские права? Сообщите нам.
Вуз:
Предмет:
Файл:Ординатура / Хирургия / Библиотека им академика М.И. Перельмана / Книга_5442_Библиотеки_им_академика_М_И_Перельмана.pdf
(Anantha Narayana & Johnson, 2019). In 2016 British Pharmacopoeia published
“Deoxyribonucleic acid (DNA) based identification techniques for herbal drugs”—a new
appendix method, with a focus on plant sampling, barcode regions, DNA extraction, puri-
fication, and amplification (
B.P. Commission, 2017). In the United States, the seque nces ref-
erence database United States Pharmacopoeia (USP) (
Appendix 1, n.d.) monograph has
got a section (DNA-based methods for authentication of articles of botanical origin), which
describes DNA-based identification methods and the USP (
Appendix 1, 2018) has pro-
vided detailed procedures for DNA-based methods and nucleic acid-based genotyping
techniques. Chinese Pharmacopoeia Commission (
CP Commission, 2017) has published
guidelines on molecular DNA barcoding of Chinese Materia Medica. These pharmacopeias
have been recognized and included in the general monographs with detailed guidance
and test methods for using either DNA barcodes or testing for intact nucleic acidbase
pairs. It was suggested that DNA-based testing can be done as an additional identity con-
firmation, particularly when other identity tests are inconclusive. However, none of these
pharmacopeias have made DNA-based identification methods mandatory.
One of the major limitations of DNA barcoding is the inability of the DNA Sanger
sequencing technique to detect DNA in herbal products containing more than one species
such as polyherbal products (
Ivanova, Kuzmina, Braukmann, Borisenko, & Zakharov,
2016
). The synergistic action of polyherbal products is one of the fundamentals to the prac-
tices of traditional medicines and the use of such specific combinations of medicinal plants
results in an enhanced outcome (
Parasuraman, Thing, & Dhanaraj, 2014). To ensure the
quality, safety, and efficacy of such polyherbal products each of the ingredients included
in the product must be identified. Several comprehensive reviews on DNA-based authenti-
cation of botanicals have highlighted the merits and demerits of Sanger sequencing-based
DNA barcoding (
de Boer et al., 2015; Ganie et al., 2 015). Nowadays, DNA metabarcoding,
which is a combination of DNA barcoding and high-throughput DNA sequencing method,
offers several key advantages over conventional DNA barcoding such as
FIGURE 11.1 Different stages in herbal products production and the role of different methods in quality con-
trol and authentication. *Chemical methods are also commonly used for authentication. Source: Adapted from
Raclariu, A.C., Heinrich, M., Ichim, M.C., & de Boer, H. (2018). Benefits and limitations of DNA barcoding and metabar-
coding in herbal product authentication. Phytochemical Analysis, 29, 123128.
364 11. Value chains and DNA barcoding for the identification of antiinfective medicinal plants
Medicinal Plants as Anti-infectives
mass-amplification and sequencing of barcodes from a complex mixture of multiple spe-
cies, analyzing samples with varying levels of DNA degradation, products containing fil-
lers, or contaminants, and superior sensitivity of the method (
de Boer et al., 2015; Taberlet,
Coissac, Pompanon, Brochmann, & Willerslev, 2012
).
In this chapter, we highlight the value chain of selected antiinfective plants, that is, how
the plants are collected from the wild and traded in local markets (unregulated markets),
and the possibilities of misidentification during collection and its consequences for drug
safety. We also discuss the role of DNA barcoding in the identification of antiinfective
plants/herbal products that are traded.
Materials and methods
A general list of antiinfective plants was derived from the Indian Medicinal Plant
Database, National Medicinal Plants Board, Government of India
http://www.medicinal-
plants.in/
. Furthermore, using a set of criteria such as plants that have species complex, con-
servation status, highly traded, and are prone to adulteration, seven species have been
shortlisted from 1178 species that are reported to be highly traded in India. Nomenclature
follows The Plant List (The Plant List, 2013,
http://www.theplantlist.org/) and Angiosperm
Phylogeny Group IV (
Chase et al., 2016).
Results and discussion
Embelia ribes—anthelmintic plant
Vidanga is an Ayurvedic herb, which is a first-line drug of choice for deworming (an
anthelmintic drug) in Ayurvedic medicine. The Ayurvedic Pharmacopoeia of India corre-
lates Vidanga to the fruits of E. ribes and E. tsjeriam-cottam (Roem. & Schult.) A. DC. as a sub-
stitute (
Venkatasubramanian et al., 2013). The annual consumption of Vidanga during the
year 201415 was estimated as 773 metric tons (dry weight) with an average price of
B710 USD/kg by Indian herbal industries (
Goraya & Ved, 2017). Due to overexploitation,
E. ribes has been listed in the priority species list’ for cultivation by the National Medicinal
Plant Board of India. Similarly, E. tsjeriam-cottam was also reported to be a species that need
priority conservation management (
Mhaskar et al., 2011). Owing to the high demand for
Vidanga in herbal markets, it is reported that it is being adulterated with other closely
related species such as E. basaal (Roem. & Schult.) A. DC., Maesa indica Roxb., and Myrsine
africana L. (
Venkatasubramanian et al., 2013; Devaiah & Venkatasubramanian, 2008).
Embelin (2,5-dihydroxy-3-undecyl-1,4-benzoquinone) is the major active constituent in the
fruits of E. ribes. Fruits/berries of E. ribes and embelin have been extensively studied for their
anthelmintic activity.
Venkatasubramanian et al. (2013) comparatively studied the anthelmin-
tic activity of E. ribes, E. tsjeriam-cottam, Maesa indica,andMyrsine africana, and reported that
the bioactivity of E. tsjeriam-cottam was comparable to E. ribes, followed by Myrsine africana
and Maesa indica. Furthermore, the embelin content in the fruits of E. ribes, E. tsjeriam-cottam,
and Myrsine africana were 5.94%, 4.32%, and 1.85% (wt./wt.), respectively, whereas Maesa
365Results and discussion
Medicinal Plants as Anti-infectives
indica contains kiritiquinone at 4.4% (wt./wt.). Though E. ribes showed better bioactivity, the
plant has been assessed as an endangered plant due to premature harvesting of fruits, habi-
tat degradation, unsustainable and indiscriminate harvest. Therefore
Venkatasubramanian
et al. (2013)
concluded E. tsjeriam-cottam can be used as a substitute anthelmintic drug for
endangered E. ribes and suggested that it can be a good conservation strategy.
Peters, Balick, Kahn, and Anderson (1989) cited many examples of how harmful har-
vesting methods and excessive harvesting of various products from oligarchic forests of
Amazonia have resulted in reduced f ruit yields and abundance of the targeted species,
as well as damage to forest structure. Similarly,
Pandey and Shackleton (2012) reported
the harvesting approaches for E. tsjeriam-cottam fruits in India. I t was reported that gen-
erally, the harvesters target immature fruits (green) in October and November by cutting
or breaking fruit-bearing branches. The branches were carried home and the fruits
were plucked. The method of harvest leads t o low-quality fruits because the bioactive
compounds for the medicinal properties are reputed to accumulate with maturation.
This harvesting method also removes the seed from the forest, thereby reducing the
number of available seeds for natural regeneration. Furthermore, the concentration of
embelin content increased as fruits ripened during December ( 3.58% 3.99%) and was at
a minimum concentration in September when the fruits were immature (1.01%1.45%)
(
Pandey & Shackleton, 2012).
Embelin is one of the major bioactive constituents and a marker compound in E. ribes
fruits. A number of studies have utilized embelin as a marker compound for the standardi-
zation of E. ribes-based herbal drugs and for quality control. For example,
Madhavan,
Arimboor, and Arumughan (2011)
developed reversed-phase high-performance liquid chro-
matography coupled with diode array detection for the quantification of embelin. It was
reported that the solvent hexane showed a higher extractability of embelin than ethyl ace-
tate, chloroform, and methanol. The linearity, limit of detection, limit of quantification,
recovery, and precision for the developed method were reported to be 15250, 3.97,
13.2 mg/mL, 99.4%103.8%, and 1.43%2.87%, respectively. Furthermore, analyzing the
commercial phytopharmaceuticals labeled to contain E. ribes revealed the presence of the
marker compound embelin in the phytopharmaceuticals (
Madhavan et al., 2011). However,
one of the disadvantages of the chemical methods is that the identity of species may not be
ascertained due to the fact that the same marker compound can also be detected in similar
congeneric species, such as in E. tsjeriam-cottam (
Venkatasubramanian et al., 2013).
DNA markers do not correspond to the chemical profile; they are not tissue specific and thus
can be detected at any stage of development, with a small amount of sample, in any physical
form.
Devaiah and Venkatasubramanian (2008) developed random amplified polymorphic DNA
(RAPD)-based sequence-characterized amplified region (SCAR) for E. ribes that distinguishes
from other traded plants E. tsjeriam-cottam, Maesa indica,andMyrsine africana.Thedeveloped
RAPD-SCAR marker OPF 05 (Forward primer CTATCGCATGCCTCACAATATCATAAT;
Reverse primer GAATCAAGTGGCTCTTGGGAGTAAGC) yields an amplicon of 594 bp only
for E. ribes. Though RAPD-SCAR is still widely used, one of the disadvantages is the need for
sequence data to design the SCAR primers (
Ganie et al., 2015). Santhosh Kumar et al. (2018) uti-
lized DNA barcoding method to authenticate the raw herbal drugs traded as Vidanga (eight sam-
ples) in India and revealed that only two samples were E. ribes and three samples each were
E. tsjeriam-cottam and Maesa indica, respectively. The results indicated the endangered plant
366 11. Value chains and DNA barcoding for the identification of antiinfective medicinal plants
Medicinal Plants as Anti-infectives
E. ribes are still traded in India and the morphologically similar species Maesa indica in trade might
reduce the safety and efficacy of anthelmintic drugs (
Santhosh Kumar et al., 2018).
Swertia chirayita—antiviral plant
Swertia chirayita (Roxb.) Buch.-Ham. ex C.B. Clarke is also known as chirata; one of the
highly traded perennial herb belonging to the family Gentianaceae spread across the high alti-
tude Himalayas with a fragment distribution from India to Nepal and Bhutan (
Scartezzini &
Speroni, 2000
). In India, 40 species of Swertia were recorded, of which, S. chirayita is consid-
ered the most important for its medicinal properties (
Misra et al., 2010). S. chirayita is listed as
one of the 32 high-priority medicinal plants by the National Medicinal Plant Board of India
(
Shukla, Dhakal, Uniyal, Paul, & Sahoo, 2017) and also included in the prioritized 30 medici-
nal plant species for economic development by the Government of Nepal. In 2014 the govern-
ment of Nepal reported S. chirayita as one of the highest export revenue earning medicinal
plants of the country (
Cunningham, Brinckmann, Schippmann, & Pyakurel, 2018; Khanal,
Shakya,Nepal,&Pant,2014;Susanna&Kumar,2011
). However, only 5% of S. chirayita was
utilized by Nepal and about 60% was exported to India and 35% to Tibet [about 675.6 of 711
metric tons (MT)] (
Cunningham, Brinckmann, Schippmann, & Pyakurel, 2018; Susanna &
Kumar, 2011
). During the year 201415, 404.7 MT of S. chirayita were consumed by the herbal
industries in India (
Goraya & Ved, 2017). Overharvesting along with habitat destruction
resulted in the drastic reduction of S. chirayita in the wild population, hence the wild harvest
was prohibited and conservation management was prioritized by the Government of India
(
Goraya & Ved, 2017). In Nepal, about 90% of the medicinal plants traded are collected from
the wild by local collectors and sold to the local traders. The trade of S. chirayita usually con-
tains four levels of stakeholders: the local collectors, the local trader, road head trader, and the
wholesaler. A comprehensive review on the trade route of S. chirayita is discussed by
Cunningham, Brinckmann, Schippmann, and Pyakurel (2018). In India, the whole plant is col-
lected during the flowering season of July and October. In Nepal, it is harvested between
October and November with a seasonal prohibition on harvest and trade between May to
September (
Pyakurel & Baniya, 2011; Susanna & Kumar, 2011). The International Union of
Conservation of Nature categorized S. chirayita as critically endangered.
Cultivation of S. chirayita has been also reported from the eastern parts of Nepal and
India. In 201213, a total of 232 MT of cultivated S. chirayita was collected and traded
from eastern Nepal, out of which 152 MT were exported to India and 80 MT were
exported to Tibet (
Cunningham, Brinckmann, Schippmann, & Pyakurel, 2018; Susanna &
Kumar, 2011
). Also, the German Federal Ministry for Economic Cooperation and
Development (BMZ) and the German Federal Enterprise for International Cooperation are
supporting companies in Nepal to uphold trade in the 30 “most exportable” medicinal
plants, including S. chirayita (
Cunningham, Brinckmann, Schippmann, & Pyakurel, 2018).
Traditionally, decoctions of S. chirayita are used as anthelmintic, antimalarial, antifungal,
antibacterial, antifatigue, antiinflammatory, antiaging, and antidiarrheal, and the extracts
of S. chirayita showed antihepatitis B virus activities (
Kumar & Staden, 2016; Zhou et al.,
2015
). This species was first documented in the Edinburgh Pharmacopeia in 1839 and is
reported in Indian Ayurvedic Pharmacopeia, British, and American Pharmacopeia (
Joshi
& Dhawan, 2005). S. chirayita is found to have a number of bioactive chemical constituents
367Results and discussion
Medicinal Plants as Anti-infectives
and the first isolated dimeric xanthone was chiratanin present in different parts of S. chir-
ayita and other major phytoconstituents including amarogentin, swertiamarin, mangiferin,
swerchirin, sweroside, amaroswerin (
Joshi & Dhawan, 2005; Kumar & Staden, 2016).
The trade and economic importance of chirata are not without adulteration/substitution
concern. S. chirayita is often misidentified or substituted with allied congeneric species and
geographically co-occurring species phenotypically very similar to Swertia species. The
morphologically similar species that could easily be misidentified and mixed within herbal
products are collected from the wild by local farmers or collectors who often rely only on
their experience in identifying the species, and the services of specialists like taxonomists
are rarely used for authentication (
Susanna & Kumar, 2011). For example, other Swertia
species such as S. alata C.B. Clarke, S. angustifolia Buch.-Ham. ex D. Don, S. bimaculata
(Siebold & Zucc.) Hook.f. & Thomson ex C.B. Clarke, S. ciliata (D. Don ex G. Don) B.L.
Burtt, S. cordata (Wall. ex G. Don) C.B. Clarke, S. densifolia (Griseb.) Kashyapa, S. dilatata
C.B. Clarke, S. elegans Wall., S. lawii Burkill, S. minor T. Cooke, S. paniculata Wall., and
S. racemosa (Wall. ex Griseb.) C.B. Clarke, considered to be inferior in medicinal quality,
are mixed with S. chirayita (
Barakoti, Chapagain, Thapa, & Bhusal, 1999; Khanal, Shakya,
Thapa, & Pant, 2015
). In Tibetan pharmacopeia, Swertia mussotii Franch., Swertia ciliata,
and other species were recommended as a substitute of S. chirayita (
Li et al., 2020).
However, the chemical constituents differ in various species (e.g., iridoids, xanthones, and
triterpenes) and have different therapeutic and pharmacological effects (
Khanal et al.,
2015; Kumar & Staden, 2016
).
The adulteration in chirata is also often due to the same vernacular name being applied
to different species in various indigenous systems of medicine or incorrect use of scientific
generic names for the raw drugs. Species of other genera such as Andrographis paniculata,
Exacum tetragonum Roxb., E. pedunculatum L., Slevogtia orientalis Griseb. are reported to be
adulterants/substitutes due to similar vernacular names (
Joshi & Dhawan, 2005). For exam-
ple, in Unani medicine, the trade name of A. paniculata is “Chirayita Desi” (southern chira-
ta), and both species share the name “Kiriyattu” in Malayalam language, “Kiratatikta” in
Sanskrit, and “Nilavembu” in Tamil language (
Goraya & Ved, 2017). Apparently, the herbs
with identical vernacular names result in adulteration/substitution. However, the major
chemical constituents of A. paniculata are kalmeghin, diterpenes: andrographolide, androgra-
phiside, neoandrographolide as well as panicolide, caffeic acid, chlorogenic acid, and other
polyphenolics (
Li et al., 2007). These compounds are entirely different from that of S. chirayita
and thus may result in different therapeutic and pharmacological effects.
Morphologically, the authentic S. chirayita can be distinguished from other substitutes
and adulterants by its intense bitterness, brownish-purple stem (dark color), continuous
yellowish pith, and petals with double nectaries (
Joshi & Dhawan, 2005). Prasad (2010) has
reported the diagnostic morphological characteristics that distinguish S. chirayita from
other closely related species.
Singh et al. (2019) developed an ultraperformance liquid
chromatography method to distinguish S. chirayita from the adulterant species, viz.,
S. bimaculata, S. cordata, S. ciliata, S. paniculata, and Halenia elliptica D. Don. The marker
compounds swertiamarin, mangiferin, gentiopicroside, and sweroside were evaluated,
and the limit of detection and quantification of marker compounds were in the range of
1.402.06 and 4.576.27 g/mL respectively. The hierarchical clustering analysis and prin-
cipal component analysis revealed that the samples are clustered into different groups and
368 11. Value chains and DNA barcoding for the identification of antiinfective medicinal plants
Medicinal Plants as Anti-infectives
resulted in the discrimination of study species (Singh et al., 2019). Misra et al. (2010) devel-
oped amplified fragment length polymorphism-based DNA markers for six species, viz.,
S. chirayita, S. angustifolia, S. bimaculata, S. ciliata, S. cordata,andS. alata, and reported the
species-specific polymorphic markers for the identification of the study species.
Joshi and
Li (2008) developed DNA barcodes for S. chirayita and several closely related species using
a nuclear ribosomal internal transcribed spacer (nr-ITS) and chloroplast (trnL-F) regions,
and revealed nr-ITS sequences are useful in differentiating Nepalese species commonly
used in herbal medicine.
Kshirsagar, Umdale, Chavan, and Gaikwad (2017) also indicate
that nr-ITS sequences are more suitable DNA marker s to distinguish Swertia species. In
this study, six species, viz., S. chirayita, S. densifolia, S. minor, S. lawii, S. corymbosa, and
S. angustifolia were used to evaluate four DNA barcode regions (nr-ITS, psbA-trnH, matK,
and rbcL), and the results indicate that the highest interspecific divergence was in ITS
(11.87%), followed by psbA-trnH (10.22%), matK (5.04%), and rbcL (0.99%). Furthermore,
Stalin Nithaniyal used DNA barcoding and reported that A. paniculata is traded as S. chir-
ayita in southern India (
Nithaniyal et al., 2017). Li et al. (2020) have analyzed 36 commer-
cial samples traded in Southwest China as dida (S. chirayita) using DNA barcoding and
revealed that three samples (8.3%) were authenticated as S. chirayita, two samples (5.6% )
as S. mussotii, three samples (8.3%) as S. ciliata, as recorded in the Tibetan Pharmacopeia.
The other samples were authenticated as adulterants and all of them originated from com-
mon plants belonging to the genus Saxifraga and Halenia. These findings showed that
DNA barcoding is an efficient tool for identification and authentication of S. chirayita.
Picrorhiza kurroa—antiviral plant
Picrorhiza kurroa Royle ex Benth., also known by its trade names Kutki or Kadu (dried
roots), belongs to Plantaginaceae family and is distributed at an altitude of 30005200 m
over the northwest of the central Himalayan region of the Indian subcontinent, China,
Pakistan, Bhutan, and Nepal (
Kapahi, Srivastava, & Sarin, 2008). Three Picrorhiza species
are found in the Himalayan region, among which P. kurroa is used medicinally and highly
traded. P. kurroa is listed as one of the high-priority medicinal plants by the National
Medicinal Plant Board of India and is also listed as one of the 15 species with higher eco-
nomic value (
Alam & Belt, 2009). During the year 201415, 10002000 MT of P. kurroa has
been utilized by the herbal industries in India with an average rate of 800900 rupees/kg
(
Goraya & Ved, 2017). In India, P. kurroa is collected from the Himalayan forest by wild
herb gatherers/local collectors. The collectors will gather together and proceed to high alti-
tude and camp there for the collection (
Alam & Belt, 2009). The whole plant is dug out,
and the rootstock is separated from aerial parts and rootlets, washed and dried in the sun
during the months of September and October (
Alam & Belt, 2009; Kapahi et al., 2008).
The rhizomes of Kutki are widely used in Indian traditional medicine for its effective-
ness as an antibiotic. It is also desc ribed by Ayurvedic literature as jvaraghna (antipyretic)
and visaghna (detoxifying) (
Kapahi et al., 2008). Other traditional uses of Kutki include
the treatment of asthma, jaundice, fever, malaria, snakebite, and liver disorders (
Kapahi
et al., 2008
). It is one of the major components of Arogyavardhini, an effective Ayurvedic
preparation used to treat liver diseases (
Upadhyay, Dash, Anandjiwala, & Nivsarkar,
2013). The bioactivity of P. kurroa is antimicrobial, antibacterial, antimutagenic,
369Results and discussion
Medicinal Plants as Anti-infectives
cardioprotective, hepatoprotective, antimalarial, antidiabetic, antiinflammatory, anticancer,
antiulcer, and nephroprotective activities (
Upadhyay et al., 2013). P. kurroa yields a crystal-
line product called “kutkin” which is a mixture of two major C9 iridoid glycosides such as
picroside-I and -II and kutkoside, used in more than 2000 herbal formulations (
Bhandari
et al., 2009; Bhandari, Kumar, Singh, & Ahuja, 2010). A number of studies have reported
the antiviral activity against SARS-CoV-2 (
Maurya, Kumar, Bhatt, & Saxena, 2020),
Chikungunya virus (
Raghavendhar, Tripati, Ray, & Patel, 2019), and HIV (Win et al., 2019)
of P. kurroa phytoconstituents.
Due to its overexploitation and collection from the wild, P. kurroa is categorized as an
endangered plant and is in the need of conserva tion management. Around 300400 plants
are uprooted to get 1 kg of roots (
Uniyal, Uniyal, & Rawat, 2011). Kutki is listed in CITES-
Appendix II and the Indian Red List of endangered species which restricts the trade of
noncultivated and nontraceable Kutki obtained from the wild (
Alam & Belt, 2009). In order
to meet market demands, P. kurroa is often adulterated with other species of Picrorhiza and
Lagotis cashm eriana Rupr. (Plantaginaceae). L. cashmeriana is found growing with P. kurroa,
at similar elevations and habitat of alpine Himalayas, between 3200 and 4500 m, and it is
traded under the same name of Kutki (
Kapahi et al., 2008). It is a small perennial herb
with short rootstock and fleshy thick, root fibers. P. kurroa can easily be identified by its
exerted stamens (
Kapahi et al., 2008).
A number of chemical fingerprinting methods use the principle phytoconstituents: iri-
doid glycosides, picrosides I and II, and kutkoside as marker compounds. For example,
Raj and Pal (2016) quantified the content of picroside-I and picroside-II in raw herbal
drugs of Kutki using HPLC and found that the marker compounds decreased with the
increase in storage duration (114 months) irrespective of storage condition. Furthermore,
the authors concluded that at low temperature (4
C6
C) the loss of picroside-I and
picroside-II content in the drug Kutki is less during storage (Raj & Pal, 2016). Malik, Priya,
and Babbar (2019)
analyzed 22 raw herbal drugs collected from Indian herbal markets
using DNA barcoding. Five DNA barcoding loci, viz., ITS, ITS2, matK, rbcL, and rpoC1
sequences were generated as reference sequences (from fou r voucher specimens) and
revealed that only one sample collected as Kutki was authentic and other 21 samples were
not P. kurroa, but rather matched with species such as Berberis asiatica Roxb. ex. DC.,
Andrographis paniculata, Entada abyssinica A. Rich., and Erythrophleum ivorense A. Chev.
Paris polyphylla—anthelmintic plant
Paris polyphylla Sm. (Melanthiaceae) is an important perennial medicinal plant of the
Himalayas that is increasingly being used in traditional medicines and pharmaceutical
industries (
Kunwar et al., 2020). The genus Paris comprises 24 species which are distrib-
uted in Bhutan, China, north-eastern India, Laos, Myanmar, Nepal, Thailand, Vietnam,
and one collection from Pakistan (
Cunningham, Brinckmann, Bi et al., 2018; Liu & Ji,
2012
). China has the highest number of species (22 species) with 12 endemic species
(
Cunningham, Brinckmann, Bi et al., 2018). In India, the genus is represented by two spe-
cies, namely, P. polyphylla and P. thibetica Franch. with about six intraspecific taxa. In
Vietnam, P. polyphylla is considered rare and listed as endangered and considered as
370 11. Value chains and DNA barcoding for the identification of antiinfective medicinal plants
Medicinal Plants as Anti-infectives
vulnerable in Nepal, India, and China (Cunningham, Brinckmann, Bi et al., 2018).
Unsustainable collection and harvesting practices along with other ecological factors have
driven the species to be considered as vulnerable species. The rhizome is the main mode
of regeneration though it regenerates from seeds. Overexploitation , indiscriminate harvest-
ing of whole plant and collection of the species before its reproduction maturity affect the
natural regeneration of P. polyphylla (
Cunningham, Brinckmann, Bi et al., 2018; Kunwar
et al., 2020
).
P. polyphylla rhizomes are widely sold in traditional medicine markets in China and
Nepal. China is one of the largest consumers of P. polyphylla where it is used as an ingredi-
ent in several Chinese herbal formulations (
Kunwar et al., 2020). The rhizome of various
species of genus Paris is used as a major source of raw material for “Yunnan Baiyao,” a
globally popular product used in Chinese medicine (
Cunningham, Brinckmann, Bi et al.,
2018; Kunwar et al., 2020
). The trade of P. polyphylla rhizome from Nepal grew signifi-
cantly after 2010 and the highest amounts, 58, 41, and 45 tons, were traded between 2011
and 2013 consecutively. The Ministry of Forest and Soil Conservation of Nepal reported
that 47,753 kg was collected and exported to Tibet/China (76% of total) and 24% to India
in the year 2014. The export to China often occurs through the Kathmandu airport or
through border districts. Reliable export trade data for P. polyphylla are not available from
Bhutan because the trade is mostly carried out informally. In India, all the harvested rhi-
zomes of the P. polyphylla are traded to Myanmar and other southeast Asian countries ille-
gally routed through Assam and Manipur. Illegal trading occurred either at local or
directly to the regional level through middlemen and then outside of the country. It is also
traded from Nepal to China and India. Illegal exporting of rhizomes of the P. polyphylla to
Myanmar through Indo-Myanmar border by the local traders has also been reported.
A comprehensive report on trade demand, trade route, and value chain is reviewed by
Cunningham, Brinckmann, Bi et al. (2018) and Kunwar et al. (2020).
Paris polyphylla is known as kalchung (Tamil), paris root (English), satuwa (Nepali),
Rhizoma Paridis (Chinese Pharmacopeia). It is used as anthelmintic, antispasmodic, diges-
tive, and expectorant and to treat vermifuge problems, headache, and intestinal worms.
Several other biological activities such as anticancer, antitumor, and cytotoxic, antimicro-
bial, antiangiogenic, immunostimulating, contractile, and hemostat ic have also been
reported (
Negi, Bisht, Bhandari, Bhatt et al., 2014; Yang, Jin, Zhang, Zhang, & Wang,
2017
). Secondary metabolites such as daucosterol, polyphyllin D, β-ecdysterone, Paris
saponins I, II, V, VI, VII, H, dioscin, oligosaccharides, heptasaccharide, octasaccharide, tri-
gofoenoside A, protogracillin, Paris yunnanosides G-J, padelaoside B, pinnatasterone, for-
mosanin C, and 20-hydroxyecdyson saponins are the major chemical constituents
identified in P. polyphylla (
Negi, Bisht, Bhandari, Bhatt et al., 2014; Yang et al., 2017).
The lack of supply and high price resulted in adulteration of P. polyphylla with inferior
herbs for monetary profit (deliberate adulteration) and misidentification leading to admix-
ture with other species. More specifically, P. polyphylla is often adulterated with P. thibetica,
P. tengchongensis Y.H. Ji, P. forrestii (Takht.) H. Li, P. mairei H. Le
´
v., Tupistra spp., Trillium
tschonoskii Maxim, Trillium govanianum Wall. ex D. Don, and Polygonum paleaceum Wall,
and Valeriana jatamansi Jones (
Duan et al., 2018). Liu and Ji (2012) developed polymerase
chain reactionrestriction fragment length polymorphism (PCR-RFLP) method to distin-
guish P. polyphylla from 11 other congeneric species namely P. dunniana H. Le
´
v., P. daliensis
371Results and discussion
Medicinal Plants as Anti-infectives
H. Li & V.G. Soukup, P. vietnamensis (Takht.) H. Li, P. mairei, P. cronquistii (Takht.) H. Li,
P. delavayi var. delavayi Franch., P. thibetica, P. fargessi Franch., P. delavayi var. petiolata
(Baker ex C.H. Wright) H. Li, P. marmomata Stearn, and P. axialis H. Li. The restriction
enzyme EaeI (C/GGCCA) has a restriction site specific to P. polyphylla nr-ITS sequence at
position 200. The other 11 species did not have this restricted site. The specific sizes of the
two digested products were 440 and 194 bp. The PCR-RFLP technique developed in this
study can be used to discriminate between P. polyphylla and its related species (
Liu & Ji,
2012
). Yang, Zhai, Liu, Zhang, and Ji (2011) utilized the length variation in the chloroplast
psbA-trnh loci to detect V. jatamansi in commercial medicinal Paris products and reported
the presence of V. jatamansi tissue as adulterant in medicinal Paris products.
Duan et al.
(2018)
reported DNA barcoding coupled with a high resolution melting method to distin-
guish P. polyphylla from P. thibetica, P. tengchongensis, P. forrestii, P. mairei, Tupistra spp.,
T. tschonos kii, and P. paleaceum using ITS2 sequences. The developed methods revealed
the presence of adulteration in P. polyphylla. Out of 10 market samples, five species were
identified as P. polyphylla var. yunnanensis, whereas the remaining five were adulterated
with P. tengchongensis and P. mairei. Apart from DNA methods to distinguish P. polyphylla
from its adulterants,
Xue et al. (2009) developed microscopic methods and reported the
diagnostic microscopical characteristics of 11 Paris species (
Xue et al., 2009).
Saussurea costus—anthelminthic/antiparasitic plant
The genus Saussurea (Compositae) is a medicinally important genus consisting of 400 spe-
cies, among which 62 species are reported from the Himalayan region (
Butola & Samant,
2010
). Saussurea costus (Falc.) Lipsch. is one such indigenous herb distributed at an altitude
ranging from 2000 to 3500 m in the subalpine regions of the northwester n Himalaya (Pakistan,
Jammu & Kashmir, Himachal Pradesh, and Uttaranchal). The species is listed as critically
endangered in Jammu & Kashmir, endemic to Western Ghats, and included in Appendix I of
the “Convention on Interna tional Trade in Endangered Species” (CITES) and the Wildlife
(Protection) Act, 1972 that prohibits the export of the species (Inserted by Act 44 of 1991, w.e.f.
2-10-1991) (
Kuniyal,Rawat,&Sundriyal,2015;Rathore,Debnath,&Kumar,2021).
S. costus is generally recognized as costus and by diverse vernacular names particularly
in India like kuth, postkhai, kur, kustam, sepuddy, kut, koshta, kostum, kot, and kushta
(
Kuniyal et al., 2015). The declining wild populations of medicinal plant species due to har-
vesting pressure has prompted the government agencies like National Medicinal Plant
Board in India and the domestic herbal industry to promote the cultivation of S. costus in
India (
Goraya & Ved, 2017). During 201415, around 164.65 MT of S. costus has been uti-
lized by the herbal industries in India (
Goraya & Ved, 2017). Even though the cultivation is
reported, market samples of Kustha from six major herbal markets of India showed the
presence of Ashwagandha [root of Withania somnifera (L.) Dunal] and Pushkarmool (roots of
Inula racemosa Hook.f.) (
Prasad & Subhaktha, 2002). The illegal trade of S. costus from India
to Australia, Japan, Dubai, USA, Mauritius, and the Netherland was also reported by the
Indian CITES Management Authority during the year 200405 (
Kuniyal et al., 2015).
The major constituents of the plant are dehydrocostunolides, saussureal, saussurea-
mines, lupeol palmitates, betulinic acid, flavone glycosides, and guaianolides (
Nadda, Ali,
Goyal, Khosla, & Goyal, 2020). The roots are traditionally used as an anthelmintic,
372 11. Value chains and DNA barcoding for the identification of antiinfective medicinal plants
Medicinal Plants as Anti-infectives
antiepileptic, antiinflammatory, antilarvicidal, fumigant, and anticancer (Liu et al., 2012;
Nadda et al., 2020; Negi, Bisht, Bhandari, Bhatt, Kuniyal et al., 2014
). In addition to these,
antifungal and antibacterial activities have been reported from the roots of S. costus
(
Alshubaily, 2019). The species has been used in traditional health-care systems and its
medicinal properties are well documented in traditional Chinese medicine, the Tibetan
system of medicine, and Indian system of medicine. S. costus is one of the main ingredients
in about 175 formulations documented in The Handbook of Traditional Tibetan Drugs (
Nadda
et al., 2020
).
To meet the demand, commercial cultivation is practiced at a higher scale now. It is cul-
tivated in a forested area with similar conditions where it occurs naturally. China was the
largest exporter of S. costus, it has exported 1024 tons from 1983 to 2009, and India was the
second-largest exporter (
Rathore et al., 2021). The earliest cultivation of S. costus was
reported in the early 1940s in Himachal Pradesh, and during 201415, 250 ha has been uti-
lized for the Kuth cultivation in India producing approximately 120 MT of root per year
(
Goraya & Ved, 2017). Chen et al. (2008) utilized nr-ITS sequences to distinguish S. costus
from the reported adulterants namely, Vladimiria berardioidea (Franch.) Ling, Vladimiria sou-
liei (Franch.) Ling, Vladimiria souliei (Franch.) Ling var. mirabilis Ling, Inula helenium L.,
Inula racemosa Hook.f., Aristolochia debilis Sieb. & Zucc. and Aristolochia contorta Bunge.
These substitutes and adulterants bear the same common name Muxiang (Chinese) but
with different chemical compositions. Sequencing results showed that the similarities of
ITS1, ITS2, and 5S rRNA intergenic spacers among S. costus and related species were
56.3%97.8%, 58.5%97.0%, and 26.4%77.9%, respectively, and the sequence variation
may be used as differentiation markers (
Chen et al., 2008).
Syzygium aromati cum—antimicrobial plant
Syzygium aromaticum (L.) Merr. & L.M. Perry (Myrtaceae), commonly known as clove
(flower buds) which is the commercialized part of this tree, starts to produce flower buds
after 4 years of plantation (
Corte
´
s-Rojas, de Souza, & Oliveira, 2014). Flower buds are col-
lected in the maturation phase before flowering and the collection can be done manually
or chemically mediated (
Batiha et al., 2020; Corte
´
s-Rojas et al., 2014). The largest producers
of clove are Brazil, Indonesia, India, Malay sia, Sri Lanka, Madagascar, and Tanzania. In
India, the annual trade of clove represents 500 1000 MT (
Goraya & Ved, 2017), and in
Brazil it is cultivated in approximately 8000 hectar es producing near 2500 tons per year
(
Corte
´
s-Rojas et al., 2014). Traditionally, cloves have been used to treat different microbial
infections such as scabies, cholera, malaria, and tuberculosis. It was also used for inhibit-
ing food-borne pathogens to treat viruses, worms, candida, and different bacterial and
protozoan infections (
Batiha et al., 2020; Deans, Noble, Hiltunen, Wuryani, & Pe
´
nzes,
1995
). Clove essential oil is traditionally used as a pain reliever in dental care as well as
for treating tooth infections and toothache. Moreover, eugenol has been widely used in
dentistry because it can penetrate the dental pulp tissue and enter the bloodstream. Clove
contains up to 18% of essential oil which is composed of roughly 89% of eugenol, 5%
15% of eugenol acetate and β-caryophyllene, and up to 2.1% of α-humulene. Other volatile
compounds present in lower concentrations in clove essential oil are β-pinene, limonene,
farnesol, benzaldehyde, 2-heptanone, and ethyl hexanoate (
Batiha et al., 2020).
373Results and discussion
Medicinal Plants as Anti-infectives