Garrett R.H., Grisham C.M. - Biochemistry (1999)(2nd ed.)(en)

Vesicle containing adenovirus vector

e Product of expression

cassette

Genome

1.A DNA fragment isolated from an EcoRI digest of genomic DNA was combined with a plasmid vector linearized by EcoRI digestion so sticky ends could anneal. Phage T4 DNA ligase was then added to the mixture. List all possible products of the ligation reaction.

2.The nucleotide sequence of a polylinker in a particular plasmid vector is

OGAATTCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCO

This polylinker contains restriction sites for BamHI, EcoRI, PstI, SalI, SmaI, SphI, and XbaI. Indicate the location of each restriction site in this sequence. (See Table 11.5 of restriction enzymes for their cleavage sites.)

3.A vector has a polylinker containing restriction sites in the following order: HindIII, SacI, XhoI, BglII, XbaI, and ClaI.

a. Give a possible nucleotide sequence for the polylinker.

b. The vector is digested with HindIII and ClaI. A DNA segment contains a HindIII restriction site fragment 650 bases upstream from a ClaI site. This DNA fragment is digested with HindIII and ClaI, and the resulting HindIII – ClaI fragment is directionally cloned into the HindIII – ClaI – digested vector. Give the nucleotide sequence at each end of the vector and the insert and show that the insert can be cloned into the vector in only one orientation.

4.Yeast (Saccharomyces cerevisiae) has a genome size of 1.21 107 bp. If a genomic library of yeast DNA was constructed in a bacteriophage vector capable of carrying 16-kbp inserts, how many indi-

vidual clones would have to be screened to have a 99% probability of finding a particular fragment?

5.The South American lungfish has a genome size of 1.02 1011 bp. If a genomic library of lungfish DNA was constructed in a cosmid vector capable of carrying inserts averaging 45 kbp in size, how many individual clones would have to be screened to have a 99% probability of finding a particular DNA fragment?

6.Given the following short DNA duplex of sequence (5 n3 )

ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCACATGCACACACATGACATAGGACAGATAGCAT

what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?

7. Figure 13.5b shows a polylinker that falls within the -galac- tosidase coding region of the lacZ gene. This polylinker serves as a cloning site in a fusion protein expression vector where the closed insert is expressed as a -galactosidase fusion protein. Assume the vector polylinker was cleaved with BamHI and then

FURTHER READING

Ausubel, F. M., Brent, R., Kingston, R. E., et al., eds., 1987. Current Protocols in Molecular Biology. New York: John Wiley & Sons. A popular cloning manual.

Berger, S. L., and Kimmel, A. R., eds., 1987. Guide to Molecular Cloning Techniques. Methods in Enzymology, Volume 152. New York: Academic Press.

Bolivar, F., Rodriguez, R. L., Greene, P. J., et al., 1977. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2:95 – 113. A paper describing one of the early plasmid cloning systems.

Chalfie, M., et al., 1994. Green fluorescent protein as a marker for gene expression. Science 263:802 – 805.

Chien, C.-T., et al., 1991. The two-hybrid system: A method to identify and clone genes for proteins that interact with a protein of interest. Proceedings of the National Academy of Sciences U.S.A. 88:9578 – 9582.

Cohen, S. N., Chang, A. C. Y., Boyer, H. W., and Helling, R. B., 1973. Construction of biologically functional bacterial plasmids in vitro. Proceedings of the National Academy of Sciences U.S.A. 70:3240 – 3244. The classic paper on the construction of chimeric plasmids.

Cortese, R., 1996. Combinatorial Libraries: Synthesis, Screening and Application Potential. Berlin: Walter de Gruyter.

Crystal, R. G., 1995. Transfer of genes to humans: Early lessons and obstacles to success. Science 270:404 – 410.

Goeddel, D. V., ed., 1990. Gene Expression Technology. Methods in Enzymology,

Volume 185. New York: Academic Press.

Grunstein, M., and Hogness, D. S., 1975. Colony hybridization: A specific method for the isolation of cloned DNAs that contain a specific gene.

Proceedings of the National Academy of Sciences U.S.A. 72:3961 – 3965. Article describing the colony hybridization technique for specific gene isolation.

Guyer, M., 1992. A comprehensive genetic linkage map for the human genome. Science 258:67 – 86. M. Guyer is the corresponding author for the American/French NIH/CEPH (National Institutes of Health/Centre Etude du Polymorphisme Humain) Collaborative Mapping Group. This

ligated with an insert whose sequence reads

GATCCATTTATCCACCGGAGAGCTGGTATCCCCAAAAGACGGCC . . .

What is the amino acid sequence of the fusion protein? Where is the junction between -galactosidase and the sequence encoded by the insert? (Consult the genetic code table on the inside front cover to decipher the amino acid sequence.)

8. The amino acid sequence across a region of interest in a protein is

Asn-Ser-Gly-Met-His-Pro-Gly-Lys-Leu-Ala-Ser-Trp-Phe-Val-Gly-Asn-Ser

The nucleotide sequence encoding this region begins and ends with an EcoRI site, making it easy to clone out the sequence and amplify it by the polymerase chain reaction (PCR). Give the nucleotide sequence of this region. Suppose you wished to change the middle Ser residue to a Cys to study the effects of this change on the protein’s activity. What would be the sequence of the mutant oligonucleotide you would use for PCR amplification?

article is part of the October 2, 1992, issue of Science (Volume 258, Number 1), which presents an update of progress on the Human Genome Project. See also the 1995 genome issue of Science, Volume 270, Number 5235, October 20, 1995.

Jackson, D. A., Symons, R. H., and Berg, P., 1972. Biochemical method for inserting new genetic information into DNA of simian virus 40: Circular SV40 DNA molecules containing lambda phage genes and the galactose operon of E. coli. Proceedings of the National Academy of Sciences U.S.A.

69:2904 – 2909.

Luckow, V. A., and Summers, M. D., 1988. Trends in the development of baculovirus expression vectors. Biotechnology 6:47 – 55.

Lyon, J., and Gorner, P., 1995. Altered Fates. Gene Therapy and the Retooling of Human Life. New York: Norton.

Maniatis, T., Hardison, R. C., Lacy, E., et al., 1978. The isolation of structural genes from libraries of eucaryotic DNA. Cell 15:687 – 701.

Morgan, R. A., and Anderson, W. F., 1993. Human gene therapy. Annual Review of Biochemistry 62:191 – 217.

Murialdo, H., 1991. Bacteriophage lambda DNA maturation and packaging. Annual Review of Biochemistry 60:125 – 153. Review of the biochemistry of packaging DNA into phage heads.

Palese, P., and Roizman, B., 1996. Genetic engineering of viruses and of virus vectors: A preface. Proceedings of the National Academy of Sciences U.S.A.

93:11287 – 11425. A preface to a series of papers from a colloquium on genetic engineering and methods in gene therapy.

Peterson, K. R., et al., 1997. Production of transgenic mice with yeast artificial chromosomes. Trends in Genetics 13:61 – 66.

Saiki, R. K., Gelfand, D. H., Stoeffel, B., et al., 1988. Primer-directed amplification of DNA with a thermostable DNA polymerase. Science 239:487 – 491. Discussion of the polymerase chain reaction procedure.

Sambrook, J., Fritsch, E. F., and Maniatis, T., 1989. Molecular Cloning, 2nd ed. Long Island: Cold Spring Harbor Laboratory Press. (This cloning manual is familiarly referred to as “Maniatis.”)

Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., eds. 1995. The Metabolic and Molecular Bases of Inherited Disease. The seventh edition of this classic work contains contributions from over 300 authors. A three-volume treatise, it is the definitive source on the molecular basis of inherited diseases.

Southern, E. M., 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology 98:503 – 517. The classic paper on the identification of specific DNA sequences through hybridization with unique probes.

Southern, E. M., 1996. DNA chips: Analysing sequence by hybridization to oligonucleotides on a large scale. Trends in Genetics 12:110 – 115.

Timmer, W. C., and Villalobos, J. M., 1993. The polymerase chain reaction.

The Journal of Chemical Education 70:273 – 280.

Young, R. A., and Davis, R. W., 1983. Efficient isolation of genes using antibody probes. Proceedings of the National Academy of Sciences U.S.A.

80:1194 – 1198. Using antibodies to screen protein expression libraries to isolate the structural gene for a specific protein.

Part II

Protein Dynamics

CHAPTER 14

Enzyme Kinetics

CHAPTER 15

Enzyme Specificity and Regulation

CHAPTER 16

Mechanisms of Enzyme Action

CHAPTER 17

Molecular Motors

“Now! Now!” cried the Queen. “Faster! Faster! . . . Now here, you see, it takes all the running you can do, to keep in the same place. If you want to get somewhere else, you must run at least twice as fast as that!”

LEWIS CARROLL, Alice’s Adventures in Wonderland (1865)

OUTLINE

426

Chapter 14

Enzyme Kinetics

“Alice and the Queen of Hearts,” illustrated by John Tenniel, The Nursery Alice. (Mary Evans Picture Library,

London)

Living organisms seethe with metabolic activity. Thousands of chemical reactions are proceeding very rapidly at any given instant within all living cells. Virtually all of these transformations are mediated by enzymes, proteins (and occasionally RNA) specialized to catalyze metabolic reactions. The substances transformed in these reactions are often organic compounds that show little tendency for reaction outside the cell. An excellent example is glucose, a sugar that can be stored indefinitely on the shelf with no deterioration. Most cells quickly oxidize glucose, producing carbon dioxide and water and releasing lots of energy:

C6H12O6 6 O2 88n 6 CO2 6 H2O 2870 kJ of energy

( 2870 kJ/mol is the standard free energy change [ G° ] for the oxidation of glucose; see Chapter 3). In chemical terms, 2870 kJ is a large amount of energy, and glucose can be viewed as an energy-rich compound even though at ambi-

ent temperature it is not readily reactive with oxygen outside of cells. Stated another way, glucose represents thermodynamic potentiality: its reaction with oxygen is strongly exergonic, but it just doesn’t occur under normal conditions. On the other hand, enzymes can catalyze such thermodynamically favorable reactions so that they proceed at extraordinarily rapid rates (Figure 14.1). In glucose oxidation and countless other instances, enzymes provide cells with the ability to exert kinetic control over thermodynamic potentiality. That is, living systems use enzymes to accelerate and control the rates of vitally important biochemical reactions.

● Reaction profile showing large G‡ for glucose oxidation, free energy change of 2,870 kJ/mol; catalysts lower G‡, thereby accelerating rate.

Glucose

1 Hexokinase

Glucose-6-P

2 Phosphogluco-

isomerase

Fructose-6-P

3 Phosphofructokinase

Fructose-1,6-bis P

4 Aldolase

Enzymes Are the Agents of Metabolic Function

Acting in sequence, enzymes form metabolic pathways by which nutrient molecules are degraded, energy is released and converted into metabolically useful forms, and precursors are generated and transformed to create the literally thousands of distinctive biomolecules found in any living cell (Figure 14.2). Situated at key junctions of metabolic pathways are specialized regulatory enzymes capable of sensing the momentary metabolic needs of the cell and adjusting their catalytic rates accordingly. The responses of these enzymes ensure the harmonious integration of the diverse and often divergent metabolic activities of cells so that the living state is promoted and preserved.

14.1 ● Enzymes — Catalytic Power, Specificity, and Regulation

Enzymes are characterized by three distinctive features: catalytic power, specificity, and regulation.

Catalytic Power

Enzymes display enormous catalytic power, accelerating reaction rates as much as 1016 over uncatalyzed levels, which is far greater than any synthetic catalysts can achieve, and enzymes accomplish these astounding feats in dilute aqueous

Glyceraldehyde-

3-P dehydrogenase

1,3-Bisphosphoglycerate

7 Phosphoglycerate

kinase 3-Phosphoglycerate

8

Phosphoglyceromutase

2-Phosphoglycerate

9

Enolase

Phosphoenolpyruvate

10

Pyruvate kinase

Pyruvate

● The breakdown of glucose by glycolysis provides a prime example of a metabolic pathway. Ten enzymes mediate the reactions of glycolysis. Enzyme 4, fructose 1,6, biphosphate aldolase, catalyzes the COC bond – breaking reaction in this pathway.

Percent yield

● A 90% yield over 10 steps, for example, in a metabolic pathway, gives an overall yield of 35%. Therefore, yields in biological reactions must be substantially greater; otherwise, unwanted by-products would accumulate to unacceptable levels.

Regulation

Regulation of enzyme activity is achieved in a variety of ways, ranging from controls over the amount of enzyme protein produced by the cell to more rapid, reversible interactions of the enzyme with metabolic inhibitors and activators. Chapter 15 is devoted to discussions of enzyme regulation. Because most enzymes are proteins, we can anticipate that the functional attributes of enzymes are due to the remarkable versatility found in protein structures.

Enzyme Nomenclature

Traditionally, enzymes often were named by adding the suffix -ase to the name of the substrate upon which they acted, as in urease for the urea-hydrolyzing enzyme or phosphatase for enzymes hydrolyzing phosphoryl groups from organic phosphate compounds. Other enzymes acquired names bearing little resemblance to their activity, such as the peroxide-decomposing enzyme catalase or the proteolytic enzymes (proteases) of the digestive tract, trypsin and pepsin. Because of the confusion that arose from these trivial designations, an International Commission on Enzymes was established in 1956 to create a systematic basis for enzyme nomenclature. Although common names for many enzymes remain in use, all enzymes now are classified and formally named according to the reaction they catalyze. Six classes of reactions are recognized (Table 14.1). Within each class are subclasses, and under each subclass are subsubclasses within which individual enzymes are listed. Classes, subclasses, subsubclasses, and individual entries are each numbered, so that a series of four numbers serves to specify a particular enzyme. A systematic name, descriptive