![](/user_photo/2706_HbeT2.jpg)
- •1.1. Overview
- •1.7. For information about the teachers:
- •1.8. Contact Information:
- •2. Program:
- •2.1. Introduction
- •2.2. The purpose of discipline:
- •2.3. Learning objectives:
- •2.4. Learning outcomes:
- •2.5.Prerequisites and Postdetails.
- •2.6. Summary of discipline:
- •2.7. Thematic plan of lectures, practical classes, srps and the siw Thematic plan of lectures
- •The practical classes thematic plan
- •Topical Plan for siwp
- •Thematic plan for independent student work
- •2.8. Tasks for independent students work : Topics for independent work of students:
- •2.9 Recommended literature :
- •In Russian :
- •In Kazakh:
- •In English :
- •2.11. Criteria and assessment rules:
- •The evaluation system of students' knowledge
- •Competence assessment in discipline "Molecular Biology and Medical Genetics," for 1 course students "General Medicine" specialty.
- •2.Check control
- •Presentation
- •Assessments grading scale
- •It is discussed and approved at faculty meeting from April "12" of 2012 y., the protocol No. 15
- •1. Theme: Implementation of heriditary information
- •3. Theses of lectures:
- •5. Literature:
- •6. Control questions (feedback):
- •3. Theses of lectures:
- •5. Literature:
- •6. Control questions (feedback):
- •3. Theses of lectures:
- •5. Literature:
- •6. Control questions (feedback):
- •3. Theses of lectures:
- •5. Literature:
- •6. Control questions (feedback):
- •3. Theses of lectures:
- •5. Literature:
- •6. Control questions (feedback):
- •3. Theses of lectures:
- •5. Literature
- •6. Control questions (feedback):
- •Specialty – general medicine
- •Year 2012
- •Theme: Introduction to Molecular Biology. Molecular Principles of Heredity
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •Evaluation of competence – knowledge
- •Theme: Gene Molecular Biology
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •Evaluation of competence – knowledge
- •Evaluation of competence – practical skills
- •Theme: Realization of Hereditary Information. Dna Replication
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •Evaluation of competence – knowledge
- •Problem
- •Theme: Transcription
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •Evaluation of competence – knowledge
- •Literature:
- •Control:
- •7.1. Evaluation of competence – knowledge
- •Theme: Regulation of Gene Expression
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •7.1. Evaluation of competence – knowledge
- •Evaluation of competence – practical skills
- •8.1.Control:
- •8.2. Rating of competence skills.
- •Theme: Genetic Apparatus of the Cell
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •7.1. Evaluation of competence – knowledge
- •7.2. Evaluation of competence – practical skills
- •Theme: Mitotic cycle, Mitosis, Meiosis
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •Evaluation of competence – knowledge
- •Evaluation of competence – practical skills
- •7.2.6. Solution of standard tasks:
- •1. Theme: Heredity. Types of inheritance. Independent monogenic inheritance of characteristics
- •2. Purpose:
- •3. Learning objectives:
- •4. Key questions the theme:
- •6. Literature
- •7. Control:
- •7.1. Assessment of cognitive competences (knowledge):
- •7.2. Assessment of competence skills
- •7.3. Assessment of the skills of self-improvement:
- •1.Theme: Heredity. Types of inheritance. Monogenic traits linked inheritance
- •2. Purpose:
- •3. Learning objectives:
- •4. Key questions the theme:
- •7.1. Assessment of cognitive competences (knowledge):
- •1. Theme: Effects of gene
- •2. Purpose:
- •3. Learning objectives:
- •4. Key questions the theme:
- •6. Literature
- •7. Control:
- •7.1. Assessment of cognitive competences (knowledge)
- •7.2. Assessment of competence skills
- •1. Theme: Cellular mechanisms of ontogenetic development
- •2. Purpose:
- •3.Learning objectives:
- •4. Key questions the theme:
- •6. Literature:
- •7. Control:
- •7.1. Assessment of cognitive competence - knowledge
- •1.Theme: Genetic mechanisms of ontogenetic development
- •2. Purpose:
- •3. Learning objectives:
- •4. Key questions the theme:
- •6. Literature:
- •7. Control:
- •7.1. Assessment of cognitive competence - knowledge
- •7.2. Assessment of competence skills
- •1. Title: Basics of Genetics populyatsioinoy
- •6. Handout: Test questions. 7. Literature:
- •1.Theme: Fundamentals of Ecological Genetics
- •4. Key questions the theme:
- •6. Литература:
- •7. Control:
- •7.1. Assessment of competencies - knowledge.
- •Some environmental disease caused by
- •Air pollution
- •Contamination of drinking water
- •Intestinal infections
- •7.1.6. The decision of situational problems:
- •7.2. Assessment of competence - legal competence.
- •Theme: Fundamentals of Pharmacogenetics
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •Evaluation of competence – knowledge
- •Evaluation of competence – practical skills
- •4.Osnovnye topic questions:
- •Specialty-general medicine methodology recommendation for independent work teacher-led
- •8. Control:
- •8.1.3. Filling out tables:escribe the types of apoptosis
- •1. Theme: Variability not hereditary and hereditary.
- •3. Problems of training:
- •4. Main questions of a subject:
- •6. Literature:
- •7. Control:
- •7.1. An assessment of competences – knowledge.
- •7.2. An assessment of competences – legal competence.
- •3. Problems of training:
- •4. Main questions of a subject:
- •6. Literature:
- •7. Control:
- •7.1. An assessment of competences – knowledge.
- •3.Learning objectives:
- •5.Key questions the theme:
- •7. References:
- •8. Control:
- •3.Learning objectives:
- •5.Tasks related to:
- •6.Handout material: test-2 version with 10 questions
- •7.References:
- •7.3.Konichev a .S. Sevyastanova g.A. Molecular biology m. 2005 p.N 150-196.351-379.
- •7.4.Teylor d.Grin. N.Staut u.Biology m.2002 part 3 p.N 215-242.
- •8. Control:
- •8.1.1 Quiz on topics.
- •8.1.5.The solution to the problem of restriction of dna.
- •8.1.6. Working with the human genomic databases: problem solving.
- •8.3. Control:
- •1 . Title: Control of landmark forum: "Molecular Biology of the Cell"
- •7. References: The main
- •Theme: Human Hereditary Diseases. Chromosomal Diseases
- •Object:
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •Evaluation of competence – knowledge
- •Impairment related to different types of human aneuploidy
- •Evaluation of competence – practical skills
- •Theme: Human Hereditary Diseases. MonogenicMendelian Diseases
- •Object:
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •Evaluation of competence – knowledge
- •Evaluation of competence –communicative skills
- •Solution of situational problems
- •Title: Monogenic nonmendelian human disease
- •Aims: To generate in students the knowledge of nonmendelian monogenic human disease.
- •Learning objectives:
- •Tasks related to:
- •Handout material: test-2 version with 10 questions
- •References:
- •Control:
- •Theme: Polygenic (Multifactor) Human Diseases
- •Educational Tasks:
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •Evaluation of competence – knowledge
- •Principal Questions of the Theme:
- •Literature:
- •Control:
- •Evaluation of competence – knowledge
- •Collection of anamnesis (determine the data that permit to reveal families with increased risk of birth of a child with hereditary pathology)
- •In case of chromosomal diseases In case of genic diseases
- •Title: Modern methods of prevention and treatment genetic diseases
- •Key questions the theme:
- •6. Handout: test questions.
- •7. References:
- •8.Control:
- •8.5.An algorithm preventing hereditary diseases, to determine the indications
- •6. Handout: test questions.
- •7. References:
- •8. Control:
- •1.Theme: Section control on the section "Basis of medical genetics"
- •3.Tasks of teaching:
- •7. References:
- •8. Control:
- •8.2. Rating of competence skills.
- •Title: Monogenic nonmendelian human disease
- •Learning objectives:
- •Tasks related to:
- •Handout material: test-2 version with 10 questions
- •References:
- •Control:
- •6. Handout: test questions.
- •7. References:
- •6. Handout: tests
- •7.Bibliography:
- •8. Control:
- •Title: Modern methods of prevention and treatment genetic diseases
- •Key questions the theme:
- •7. References:
- •8.Control:
- •8.5.An algorithm preventing hereditary diseases, to determine the indications
- •3.Tasks of teaching:
- •5. The main themes:
- •7. References:
- •8. Control:
- •8.2. Rating of competence skills.
- •1. Theme #1. Telomers. Telomerase activity
- •3. The tasks:
- •5. Performance criteria:
- •5. Performance criteria:
- •8. Bibliography:
- •8. Bibliography:
- •9. Check:
- •1. Theme #5. Genomics, proteomics and metabolonomics
- •3. The tasks:
- •5. Performance criteria:
- •8. Bibliography:
- •9. Check:
- •1. Theme #6. Cloning of organisms and cells
- •3. The tasks:
- •5. Performance criteria:
- •8. Bibliography:
- •8. Bibliography:
- •9. Check:
- •1. Theme #9. Molecular and genetic mechanisms of aging
- •3. The tasks:
- •5. Requirements to presentation making up:
- •8. Bibliography:
- •8. Bibliography:
- •8. Bibliography:
- •9. Check:
- •1. Theme #13. Human genetic passport
- •3. The tasks:
- •5. Requirements to abstract work design:
- •8. Bibliography:
- •8. Bibliography:
- •8. Bibliography:
- •8. Bibliography:
- •8. Bibliography:
- •8. Bibliography:
- •9. Check:
- •Control and measuring means for the assessment of knowledge, skills in molecular biology and medical genetics
- •2012 Year
- •I. Examination questions:
- •II. The test exam questions:
- •Molecular biology
- •Replication
- •II. Molecular Cell Biology
- •Cell Cycle
- •Ontogenezis
- •Mutations
- •Oncogenetics
- •III. Fundamentals of general genetics
- •Ekogenetic
- •Pharmacogenetics
- •IV. Fundamentals of medical genetics
- •The list of questions to assess the practical skills: Molecular biology
- •Genetics
Problem
A DNA sector has the following composition of nucleotides:
3 3… AGTACGGCATGCATTACATGCCGC… 5. Write the nucleotide composition of daughter DNA formed as a result of replication of the initial DNA fragment. Indicate which of polynucleotide chains are old and new.
Fill in the table Functions of Ferments Taking Part in DNA Replication
Pos. |
Ferments |
Functions |
1. |
Helicase |
|
2. |
SSB-protein |
|
3. |
Topoisomerase |
|
4. |
DNA-polymerase |
|
5. |
Primase |
|
6. |
DNA-ligase |
|
7. |
Endonuclease |
|
Lesson 4
Theme: Transcription
Object: Form students’ knowledge of molecular mechanisms of realization of hereditary information on the level of transcription in prokaryotes.
Educational Tasks:
to form students’ knowledge of the essence of transcription;
to study molecular mechanisms of different stages of transcription;
to study and understand peculiarities of transcription in prokaryotic organisms;
to study the role of transcription in providing functioning of living organisms;
to study and understand the significance of impairment of transcription in occurrence of pathologic processes (diseases);
to know terms
Principal Questions of the Theme:
4.1. Transcription, definition, characteristics
4.2. Matrix principle of synthesis of i-RNA, difference of transcription from replication
4.3. Mechanisms of transcription of prokaryotic genes:
initiation
elongation
termination
Methods of Teaching:interrogation aimed at clarification of students’ understanding of the essence, object, and objectives of the lesson; ability to briefly, clearly, logically recount and ability of draw the learnt material in the form of schemes, diagrams, drawings; testing with subsequent discussion of errors; work in group: explanation and demonstration of problem solution, filling-in tables.
Literature:
Basic:
Genetics. Under redaction of Ivanov V.I.M., 2006, pp.201-210
Ginter Y.K.Medical Genetics.M.,2003, p.35-46
Muminov T.A., Kuandykov Y.U. Fundamentals of Molecular Biology (Course of Lectures). Almaty, 2007, pp. 42-64
Mushkambrov N.N., Kusnetsov S.L.Molecular Biology. M., 2003, pp. 85-148
Yarygin
Medical Biology and Genetics. Study guide under redaction of Prof. Kuandykov Y.U. Almaty, 2004, pp. 29-41
Additional
6.1. Konichev A.S., Sevastayanova G.A. Molecular Biology. M., 2005, p.234-295
6.2. Lyuin B. Genes. M., 1987, p.132-174, 310-342
6.3. Zhimulyov I.F. General and Molecular Genetics. Novosibirsk. 2003, pp. 123-126, 172-196