- •Dedication
- •Dedication
- •Preface
- •Contents
- •Contributors
- •Travel Awards
- •About the Editors
- •1.1 Introduction
- •1.2 Methods
- •1.2.1 RNA Preparation and cDNA Labeling
- •1.2.2 Hybridization of Slides, Image Acquisition and Bioinformatics
- •1.2.3 Real-Time PCR
- •1.3.2 Microarray Analysis of Bouse C Model
- •1.3.3 Microarray Analysis of MOT1 Mouse
- •1.4 Discussion
- •References
- •2 Regulation of Angiogenesis by Macrophages
- •2.1 Macrophage Polarization and Its Role in Angiogenesis
- •References
- •3.1 Introduction
- •3.2 Materials and Methods
- •3.2.1 Reagents
- •3.2.2 Animals and Retina Explant Culture
- •3.2.3 Cell Culture
- •3.2.4 Western Blot Assay
- •3.3 Results
- •3.3.1 Phorbol Esters Increase Rod Generation
- •3.3.2 Expression of PKC Isoforms in Developing Retina
- •3.3.3 Activation of PKC Decreases Phosphorylation of STAT3
- •References
- •4.1 Introduction
- •4.3 In Silico Information
- •4.4 Expression and Distribution in the Retina
- •4.5 Transmembrane Topology
- •4.6 Binding to PEDF Ligands
- •4.7 Phospholipase Activity
- •4.8 PEDF-R Activity in Retinal Cells
- •4.9 Conclusions
- •References
- •References
- •6 The Association Between Telomere Length and Sensitivity to Apoptosis of HUVEC
- •6.1 Introduction
- •6.2 Methods
- •6.2.1 The Culture of HUVEC and the Construction of Cell Division Model
- •6.2.2 Construction of an Apoptosis Model of HUVEC with Free Hydroxyl Radicals
- •6.2.3 Measurement of Apoptosis Rates and Telomere Lengths
- •6.2.4 Statistics Analysis
- •6.3 Results
- •6.3.1 Relationship Between the Time of Culture and the Telomere Length
- •6.3.2 Relationship Among Apoptosis Rates, Culture Times and Oxidation
- •6.3.3 Oxidation Enhances the Telomere Shortening
- •6.4 Discussion
- •References
- •7.1 Regulation of cGMP Levels in Photoreceptor Outer Segments
- •7.2 Retinal Disorders Associated with Mutations in RetGCs and PDE6
- •7.3 Analysis of Teleost RetGC and PDEs in Retinal Function and Disorders
- •References
- •8 RDS in Cones Does Not Interact with the Beta Subunit of the Cyclic Nucleotide Gated Channel
- •References
- •9.1 Introduction
- •9.2 Material and Methods
- •9.2.1 Animals
- •9.2.2 Methods
- •9.2.3 Statistical Analysis
- •9.3 Results
- •9.4 Discussion
- •References
- •10.1 Introduction
- •10.2 Methods and Results
- •10.2.1 ZBED4 mRNA is Expressed in Human Retina
- •10.2.2 ZBED4 mRNA is Expressed in Mouse and Human Cones
- •10.2.3 ZBED4 is Expressed Both in Nuclei and Cytoplasm of Human Cones
- •10.2.3.1 Human ZBED4 is Also Expressed in Müller Cells Endfeet
- •10.2.4 Human ZBED4 is Distributed Between Nuclear and Cytoplasmic Retinal Fractions
- •10.2.5 Subcellular Localization of ZBED4 in Stably Transfected Cells
- •10.3 Discussion
- •References
- •11 Tubby-Like Protein 1 (Tulp1) Is Required for Normal Photoreceptor Synaptic Development
- •11.1 Introduction
- •11.2 Methods
- •11.2.1 Animals
- •11.3 Results
- •11.4 Discussion
- •References
- •12.1 Introduction
- •12.2 Experimental Procedures
- •12.2.1 Animal
- •12.2.2 Immunohistochemistry
- •12.2.3 RT-PCR Analysis
- •12.2.4 Behavioral Analysis
- •12.3 Results
- •12.4 Discussion
- •12.4.2 GAP43 Is a Good Marker for Monitoring the Long Process of Optic Nerve Regeneration in Fish
- •References
- •13 Multiprotein Complexes of Retinitis Pigmentosa GTPase Regulator (RPGR), a Ciliary Protein Mutated in X-Linked Retinitis Pigmentosa (XLRP)
- •13.1 X-Linked RP (XLRP)
- •13.2 Retinitis Pigmentosa GTPase Regulator (RPGR)
- •13.3 RPGR Isoforms in the Retina
- •13.4 Animal Models of RPGR
- •13.5 Sensory Cilia
- •13.6 Retinal Degeneration Caused by Mutations in Ciliary Proteins
- •13.9 Conclusion
- •References
- •14 Misfolded Proteins and Retinal Dystrophies
- •14.1 Endoplasmic Reticulum Stress and Retinal Degeneration
- •14.2 Misfolded Proteins in Photoreceptors
- •14.3 Misfolded Proteins in Retinal Pigment Epithelial Cells
- •14.4 Pharmacologic Targeting of Protein Misfolding to Prevent Retinal Degeneration
- •References
- •15.1 Introduction
- •15.6 Perspective
- •References
- •16.1 Introduction
- •16.2 RCS Rat and MerTK Receptor: An Intimate Story
- •16.3 Changes Associated with Absence of MerTK in the Rat Retina
- •16.4 Daily Rhythmic Activation of Mertk: The Intracellular Way
- •16.5 The Debate About MerTK Ligands In Vivo
- •16.6 Perspectives
- •References
- •17.1 Introduction
- •17.3 Implications for IRBP and Cone Function
- •17.4 The Cone Visual Cycle
- •References
- •18.1 Introduction
- •18.2 Material and Methods
- •18.2.1 Reagents
- •18.2.2 Cell Culture
- •18.2.3 Flow Cytometry
- •18.3 Results
- •18.3.2 Oxidative Stress of Renal Tubular Epithelial Cells Does Not Alter Surface Expression of Crry by the Cells
- •18.4 Discussion
- •References
- •19 Role of Metalloproteases in Retinal Degeneration Induced by Violet and Blue Light
- •19.1 Introduction
- •19.2 Objective
- •19.3 Materials and Methods
- •19.4 Results
- •19.5 Conclusion
- •References
- •20.1 Summary
- •20.2 Introduction
- •20.3 Materials and Methods
- •20.3.1 Primary Human RPE Cell Culture
- •20.3.3 Mitochondrial Morphometrics
- •20.3.4 Protein and Weight Estimation of RPE Cells and Mitochondria
- •20.3.7 Expression of Mitochondrial Associated Genes
- •20.4 Results
- •20.4.1 Age Related Sensitivity of RPE Cells to Oxidative Stress
- •20.4.2 Variation in Mitochondrial Number, Structure, and Size
- •20.4.5 Expression of Genes Associated with Mitochondrial Function
- •20.5 Discussion
- •References
- •21 Ciliary Transport of Opsin
- •21.1 Introduction
- •21.2 Methods
- •21.3 Results
- •21.4 Discussion
- •References
- •22 Effect of Hesperidin on Expression of Inducible Nitric Oxide Synthase in Cultured Rabbit Retinal Pigment Epithelial Cells
- •22.1 Introduction
- •22.2 Materials and Methods
- •22.2.1 Preparing Hesperidin Extract of Pericarpium Citri Reticulatae
- •22.2.3 Cell Culture
- •22.2.4 MTT Cell Viability Assay
- •22.2.5 Assay of NO Production
- •22.2.6 Cellular Immunohistochemistry of iNOS
- •22.2.7 Statistical Analysis
- •22.3 Results
- •22.3.2 RPE Cells Morphology
- •22.3.4 Assay of NO and iNOS
- •22.4 Discussion
- •References
- •23.1 Introduction
- •23.2 Materials and Methods
- •23.2.1 Rabbit Retina Tissues
- •23.2.2 RNA Extraction
- •23.2.3 miRNA Microarray Analysis
- •23.2.4 Data Analysis
- •23.2.5 Bioinformatics Analysis of the Selected Mirnas
- •23.3 Results and Discussion
- •23.3.1 miRNA Microarray Analysis
- •23.3.2 Putative miRNA Target Gene Prediction
- •References
- •24.1 Introduction
- •24.2 Materials and Methods
- •24.2.1 Experiment with Animals
- •24.2.2 -Galactosidase Assay
- •24.3 Results
- •24.3.1 Generation of Transgenic Mice
- •24.3.2 Localization of Cre Function in Transgenic Mice
- •24.4 Discussion
- •References
- •25.1 Introduction
- •25.2 Methods
- •25.3 Result
- •25.4 Conclusions
- •References
- •26.1 PSC Proteins Involved in Inherited Retinal Degenerations
- •26.2 Structure of Photoreceptor Sensory Cilium Complex
- •26.3 Protein Components of Photoreceptor Sensory Cilium: PSC Proteome
- •26.4 Novel Photoreceptor Cilia Proteins in PSC Proteome
- •26.4.1 Subcellular Locations of Candidate Novel PSC Proteins
- •26.4.2 Functional Analysis of Novel PSC Proteins in Photoreceptor and Renal Cilia
- •26.4.2.1 shRNAs Against Novel PSC Genes
- •26.4.2.2 Evaluation of Phenotypes of shRNA Knockdown in mIMCD3 Cells and PSCs
- •26.5 TTC21B Protein in Photoreceptor Sensory Cilia and Renal Primary Cilia
- •26.5.1 TTC21B Localizes to the Basal Bodies and Transition Zone of Primary and Photoreceptor Sensory Cilia
- •26.5.2 TTC21B is Required for Primary Cilia and Photoreceptor Sensory Cilia Formation
- •26.6 Future Direction: Screening Novel PSC Genes for Mutations that Cause IRDs
- •References
- •27.1 Introduction
- •27.2 Materials and Methods
- •27.2.1 RNA Interference
- •27.2.2 Construction of Mouse Anti Elovl4 Gene shRNA
- •27.2.3 Tissue Culture
- •27.2.4 Fatty Acid Analysis
- •27.3 Results
- •27.3.1 661W Cells Express Elovl4 and Can Elongate 18:3n3 and 22:5n3 to Longer Chain Fatty Acids
- •27.4 Discussion
- •References
- •28 Molecular Pathogenesis of Achromatopsia Associated with Mutations in the Cone Cyclic Nucleotide-Gated Channel CNGA3 Subunit
- •28.1 Introduction
- •28.2 Materials and Methods
- •28.2.1 Constructs, Cell Culture and Transfection
- •28.2.3 Electrophysiological Recordings
- •28.2.4 SDS-PAGE and Western Blot Analysis
- •28.3 Results
- •28.3.1 The R218C and R224W Mutations Cause Loss of Channel Function
- •28.4 Discussion
- •References
- •29.1 Introduction
- •29.2 Materials and Methods
- •29.2.1 Patients and Ophthalmologic Examinations
- •29.2.2 Molecular Genetic Analysis
- •29.3 Results and Discussion
- •29.3.1 adRP
- •29.3.2 Bothnia Dystrophy
- •29.4 Conclusions
- •References
- •30.1 Introduction
- •30.2 Properties of Rhodopsin CSNB Mutants
- •30.2.1 Spectral and Photochemical Properties
- •30.2.2 Retinal Binding Kinetics of Rhodopsin CSNB Mutants
- •30.2.3 Activity of CSNB Mutants
- •30.2.3.1 In Vitro Assays of CSNB Mutants
- •30.2.3.2 Electrophysiological Studies on Transgenic Animal Models
- •30.3 Proposed Mechanisms of CSNB Mutations
- •30.3.1 Desensitization Due to Mutant Opsin Activity in Xenopus
- •30.3.2 Proposed Dark-Active Rhodopsin in Mouse
- •30.4 Future Studies
- •References
- •31 GCAP1 Mutations Associated with Autosomal Dominant Cone Dystrophy
- •31.2 Guanylate Cyclase 1 (GC1) and GCAP1
- •31.3 The EF Hand Motifs of GCAP1
- •31.5 EF3: The GCAP1(Y99C) and GCAP1(N104K) Mutations
- •31.6 EF4: The GCAP1(I143NT), GCAP1(L151F) and GCAP1(E155G) Mutations
- •31.7 Conclusion
- •References
- •32.1 Introduction
- •32.2 Methodology
- •32.2.1 Molecular Genetic Studies
- •32.2.2 Electrophysiological Studies
- •32.3 Results
- •32.3.1 RS1 Mutations in Western Australian Families
- •32.3.3.1 Family Information
- •32.3.3.2 Patient Information
- •32.3.3.3 Genetic Information
- •32.4 Discussion
- •References
- •33.1 Introduction
- •33.2 Materials and Methods
- •33.2.1 Subjects
- •33.2.2 DNA Extraction
- •33.2.4 RFLP Analysis
- •33.2.5 Statistical Analysis
- •33.3 Results
- •33.4 Discussion
- •References
- •34.1 Introduction
- •34.2 Materials and Methods
- •34.2.1 Animal Experiments and Experimental Groups
- •34.2.2 Web-Based siRNA Design Protocols Targeting Claudin-5
- •34.2.4 Indirect Immunostaining of Retinal Flatmounts
- •34.2.5 Assessment of BRB Integrity by Perfusion of Hoechst (H33342)
- •34.2.6 Magnetic Resonance Imaging (MRI)
- •34.3 Results
- •34.3.1 Claudin-5 Levels in Retinal Flatmounts
- •34.3.3 MRI Analysis of Ibrb Integrity Following Rnai of Claudin-5
- •34.4 Discussion
- •References
- •35 Spectral Domain Optical Coherence Tomography and Adaptive Optics: Imaging Photoreceptor Layer Morphology to Interpret Preclinical Phenotypes
- •35.1 Introduction
- •35.2 Materials and Methods
- •35.2.1 Subjects
- •35.2.2 Adaptive Optics Retinal Imaging
- •35.2.3 Spectral Domain Optical Coherence Tomography
- •35.3 Results
- •35.3.1 Cone Photoreceptor Mosaic Topography
- •35.3.2 Outer Nuclear Layer Thickness
- •35.4 Discussion
- •References
- •36.1 Introduction
- •36.2 Pharmacological Strategies for Misfolding Mutant Rod Opsin
- •36.2.1 Pharmacological Chaperones
- •36.2.2 Kosmotropes
- •36.2.3 Molecular Chaperone Inducers
- •36.2.4 Autophagy Inducers
- •36.3 Conclusion
- •References
- •37 Targeted High-Throughput DNA Sequencing for Gene Discovery in Retinitis Pigmentosa
- •37.1 Introduction
- •37.2 Methods
- •37.2.1 Selection of Families
- •37.2.2 VisionCHIP Gene Selection
- •37.2.3 VisionCHIP Validation
- •37.2.4 Evaluating Potentially Pathogenic Variants
- •37.3 Conclusion
- •References
- •38 Advances in Imaging of Stargardt Disease
- •38.1 Introduction
- •38.4 Adaptive Optics Scanning Laser Ophthalmoscope
- •38.5 Conclusion
- •References
- •39.1 Materials and Methods
- •39.1.1 Cell Culture
- •39.1.3 VEGF Expression was Determined by ELISA
- •39.1.4 Statistical Analysis
- •39.2 Results
- •39.2.1 The Maximum Inhibition of VEGF Expression by Protamine Sulfate
- •39.2.2 Protamine Sulfate Inhibits the RF/6A Cell VEGF Expression at the Hypoxic Condition
- •39.2.3 Protamine Sulfate Inhibits the Binding of VEGF to Its Receptor
- •39.3 Discussions
- •39.3.1 The Inhibition Effect of Protamine Sulfate on VEGF
- •39.3.2 Inhibition of the Binding Between VEGF and Its Receptor
- •39.3.3 The Potential Use of Protamine Sulfate Inhibition of Angiogenic Eye Diseases
- •References
- •40.1 Introduction
- •40.2 Methods
- •40.2.1 Immunohistochemial Staining of Choroidal Endothelia
- •40.2.2 Analysis of Choriodal Density with Photoshop 8.0
- •40.3 Results and Discussion
- •40.3.1 Analysis Of Choroidal Density
- •40.3.2 Usefulness of the Methodology
- •40.3.3 Summary
- •References
- •41 Thioredoxins 1 and 2 Protect Retinal Ganglion Cells from Pharmacologically Induced Oxidative Stress, Optic Nerve Transection and Ocular Hypertension
- •41.1 Introduction
- •41.2 Methods
- •41.2.1 Animals
- •41.2.2 RGC Counting
- •41.2.3 RGC Isolation
- •41.2.4 Western Blot Analysis
- •41.2.5 RGC-5 Culture and Transfection
- •41.2.6 Cell Viability Assay
- •41.2.7 In Vivo Electroporation (ELP)
- •41.2.8 Statistical Analysis
- •41.3 Results
- •41.3.1.1 TRX Expression in RGC-5 Cells in Response to Oxidative Stress
- •41.3.1.2 The Levels of TRX Proteins After ONT
- •41.3.1.3 The Levels of TRX Proteins After IOP Elevation
- •41.3.2 The Effect of TRX1 and TRX2 Overexpression on RGC Survival
- •41.3.2.2 TRX1 and TRX2 Overexpression Increases RGC Survival After ONT
- •41.3.2.3 TRX1 and TRX2 Overexpression Increases RGC Survival After IOP Elevation
- •41.4 Discussion
- •References
- •42 Near-Infrared Light Protect the Photoreceptor from Light-Induced Damage in Rats
- •42.1 Introduction
- •42.2 Material and Methods
- •42.2.1 Animal
- •42.2.2 Light Damage
- •42.2.3 670 nm LED Treatment
- •42.2.4 Evaluation of Photoreceptor Cell Function by Electroretinography
- •42.2.5 Morphological Evaluation of Photoreceptor Rescue by Quantitative Histology
- •42.2.6 Statistical Analysis
- •42.3 Results
- •42.3.1 LED Attenuated the Light Damage Area in Retinas
- •42.3.2 LED Protected the Morphology of Light Damage Retina
- •42.3.3 LED Protected the Function of Light Damage Retina
- •References
- •43.1 Introduction
- •43.2 Methods
- •43.2.1 Animals
- •43.2.2 Cell Preparation and Subretinal Transplantation
- •43.2.3 Flash-Electroretinogram (F-ERG) Recordings
- •43.2.5 Data Analysis
- •43.3 Results
- •43.3.1 ERG Amplitudes and Latencies
- •43.3.2 ONL Thickness
- •43.3.3 Graft Cells Survival After Subretinal Transplantation
- •43.4 Discussion
- •References
- •44.1 Introduction
- •44.2 Mechanisms of ATP Release and Degradation
- •44.2.1 ATP Release
- •44.2.2 Degradation of ATP
- •44.3 Purinergic Signaling in the Retina
- •44.3.1 Purinergic Modulation of Neuronal Signaling
- •44.3.2 ATP and Glial Transmission
- •44.4 The Role of Purinergic Receptors in Retinal Disease
- •44.5 Concluding Remarks
- •References
- •45.1 Background
- •45.3 FAF Findings in Early AMD with Drusen Only
- •45.4 FAF Findings in Late AMD with Geographic Atrophy
- •45.5 Progression of Geographic Atrophy
- •45.6 Mechanisms of Progression
- •45.7 Research to Prevent Progression
- •45.8 Discussion
- •References
- •46 Endoplasmic Reticulum Stress as a Primary Pathogenic Mechanism Leading to Age-Related Macular Degeneration
- •46.1 Age Related Macular Degeneration Is a Leading Cause of Vision Loss
- •46.3 ER Stress and Oxidative Stress Interact
- •46.5 Future Experimental Approaches
- •References
- •47 Proteomic and Genomic Biomarkers for Age-Related Macular Degeneration
- •47.1 Introduction
- •47.2 Methods
- •47.3 Results
- •47.3.1 CEP Adducts and Autoantibodies Are Elevated in AMD Plasma
- •47.3.2 AMD Risk Based on CEP Biomarkers and Genotype
- •47.3.3 The Association Between CEP Biomarkers and AMD Risk Genotypes
- •47.4 Discussion
- •References
- •48.1 Introduction
- •48.2 Methods
- •48.2.1 Chemicals
- •48.2.2 Establishment and Maintenance of hRPE Cell Cultures
- •48.2.3 Cellular Proliferation
- •48.2.4 Immunoprecipitation Assay
- •48.2.5 Statistical Analysis
- •48.3 Results
- •48.3.1 Effect of Glucose on 14C-CTGF Synthesis in hRPE Cells
- •48.3.2 Effect of IGF-1 on 14C-CTGF Synthesis in hRPE cells
- •48.4 Discussion
- •References
- •49.1 Introduction
- •49.1.3 Peroxisome Proliferator Activated Receptors (PPARs) are Expressed in ARPE19 Cells
- •49.2 LcPUFA Regulates Gene Expression in ARPE19 Cells
- •49.2.1 Purpose and Methods
- •49.2.2 Results
- •49.2.3 Discussion
- •References
- •50.1 Introduction
- •50.2 Cigarette Smoking as a Risk Factor for AMD
- •50.2.1 AMD and Cigarette Smoke
- •50.2.2 Cigarette Smoke Constituents
- •50.3 Oxidative Stress
- •50.3.1 Oxidative Damage in AMD
- •50.3.2 Reactive Oxygen Species in Cigarette Smoke
- •50.3.3 Acrolein-Induced Oxidative Stress
- •50.3.4 Cadmium-Induced Oxidative Stress
- •50.4 Cigarette Smoke Depletion of Antioxidant Protection
- •50.4.1 Systemic Antioxidant Mechanisms
- •50.4.2 Local Ocular Antioxidants
- •50.5 Non-oxidative Chemical Damage by Cigarette Smoke
- •50.5.1 Nicotine
- •50.5.2 Polycyclic Aromatic Hydrocarbons
- •50.6.2 Cigarette Smoke and Complement Pathway
- •50.7 Vascular Changes
- •50.8 Conclusions
- •References
- •51.1 Oxidative Stress and Age-Related Macular Degeneration
- •51.2 The Ubiquitin Proteolytic System (UPS) and Oxidative Stress in the Retina
- •51.3 The UPS and the Cytoprotective Transcription Factor, Nrf2
- •References
- •52 Slit-Robo Signaling in Ocular Angiogenesis
- •52.1 Ocular Angiogenesis
- •52.2 Slit-Robo Signaling in Axon Guidance
- •52.3 Slit-Robo Signaling in Angiogenesis
- •52.4 Slit-Robo Signaling in Ocular Angiogenesis
- •52.5 Signaling Pathway of Slit-Robo System in Angiogenesis
- •52.6 Perspective
- •References
- •53.1 Introduction
- •53.2 Materials and Methods
- •53.2.1 Animals and Biosafety
- •53.2.2 MNU-Induced Retinal Degeneration
- •53.2.3 Electroretinography
- •53.2.4 Histological Examination and Immunohistochemistry
- •53.3 Results
- •53.3.1 Fundus Examination and Histology of the Retina
- •53.3.3 BrdU Incorporation
- •53.3.4 Immunohistology of Nestin
- •References
- •54 Differences in Photoreceptor Sensitivity to Oxygen Stress Between Long Evans and Sprague-Dawley Rats
- •54.1 Introduction
- •54.2 Methods
- •54.2.1 Animal Strains and Oxygen Exposure
- •54.2.2 Electroretinography
- •54.2.3 Immunohistochemistry and TUNEL Labeling
- •54.3 Results
- •54.3.1 Rod and Cone Components of the ERG after Hyperoxia
- •54.3.2 Impact of Hyperoxia on the Rate of Photo receptor Death
- •54.3.3 Impact of Hyperoxia on GFAP Expression
- •54.4 Discussion
- •References
- •55.1 Introduction
- •55.2 The AY9944 Rat Model of SLOS: Biochemical Findings
- •55.3 Retinal Degeneration in the SLOS Rat Model: Histology and Ultrastructure
- •References
- •56.1 Introduction
- •56.1.1 The Pde6brd1 Mouse and Increased [cGMP]
- •56.1.2 Calcium Regulation and Overload in the Photoreceptor Inner Segment
- •56.2 D-cis-diltiazem and Neuroprotection in the Retina
- •56.2.1 Criticism of the Frasson Study
- •56.3 Other Players May Be Involved
- •References
- •57.1 Introduction
- •57.2 Materials and Methods
- •57.2.1 Animals and Reagents
- •57.2.2 Induction of Retinal I/R
- •57.2.4 Statistical Analysis
- •57.3 Results
- •57.3.1 Effect of PBNA on Serum NO Content in Retinal I/R Injury
- •57.3.2 Effect of PBNA on T-NOS Activity in Retinal I/R Injury
- •57.3.3 Effect of PBNA on iNOS Activity in Retinal I/R Injury
- •57.3.4 Effect of PBNA on Serum eNOS Activity in Retinal I/R Injury
- •57.4 Discussion
- •References
- •References
- •59.1 Introduction
- •59.2 Materials and Methods
- •59.2.1 Experimental Animals
- •59.2.3 Construction of the pur-GFP Reporter Vector
- •59.2.4 Morpholino and Microinjections
- •59.2.5 In Situ Hybridization
- •59.2.6 RNA Isolation, RT-PCR and mRNA Synthesis
- •59.3 Results
- •59.3.2 Similar Phenotypes of Purpurin and Crx Morphant
- •References
- •60.1 Introduction
- •60.2 Bipolar Cell Function in Retinal Degeneration
- •60.2.1 Glutamate Receptors of Bipolar Cells in the Normal and Degenerating Retina
- •60.2.2 Evidence for Bipolar Cell Dysfunction
- •60.2.2.1 Rod Bipolar Cells
- •60.2.2.2 Cone Bipolar Cells
- •60.3 Ganglion Cell Function in Retinal Degeneration
- •References
- •61.1 Introduction
- •61.2 Methods
- •61.2.1 Animals and Rearing
- •61.2.2 Measurement of Outer Nuclear Layer Thickness
- •61.2.3 Counting Photoreceptor Nuclei
- •61.3 Results
- •61.4 Discussion
- •References
- •62.1 Introduction
- •62.2 Retinitis Pigmentosa
- •62.4 IMPDH Structure and Function
- •62.5 IMPDH Binds Single Stranded Nucleic Acids
- •62.6 Retinal Isoforms of IMPDH1
- •62.7 Kinetic and Nucleic Acid Binding Properties of Retinal IMPDH1
- •62.8 Conclusion
- •References
- •63.1 Introduction
- •63.2 Methods
- •63.3 Results
- •63.4 Discussion
- •63.5 Conclusion
- •References
- •64.1 Introduction
- •64.2 Results
- •64.2.1 Evaluation of Optimal IMPDH1 Suppressors
- •64.2.2 RP10 Mouse Model
- •64.3 Discussion
- •References
- •65 Correlation Between Tissue Docosahexaenoic Acid Levels and Susceptibility to Light-Induced Retinal Degeneration
- •65.1 Introduction
- •65.2 Methods
- •65.3 Results
- •65.4 Discussion
- •References
- •66.1 Introduction
- •66.2 Materials and Methods
- •66.2.1 Animal
- •66.2.2 Immunohistochemical Staining
- •66.2.3 Western Blot Test
- •66.2.4 Müller Cell Cultures
- •66.2.5 Data Analysis
- •66.3 Results
- •66.3.1 Morphology and Quantity Changes of Müller Cells
- •66.3.2 Expression of GFAP and ERK in RCS Rat Müller Cells
- •66.3.3 Effect of Mixed Retinal Cells of RCS Rats on Normal Müller Cells
- •66.4 Discussion
- •References
- •67.1 Introduction
- •67.2 Materials and Methods
- •67.2.1 Animals and Reagents
- •67.2.2 Induction of RI/R
- •67.2.4 Statistical Analysis
- •67.3 Results
- •67.3.1 The Effect of DSS on the Concentration of MDA in Serum After RI/R Injury
- •67.3.2 The Effect of DSS on the Activity of SOD in Serum After RI/R Injury
- •67.3.4 The Effect of DSS on the Concentration of Serum NO After RI/R Injury
- •67.4 Discussion
- •References
- •68.1 Introduction
- •68.2 Materials and Methods
- •68.2.1 Animals
- •68.2.2 Functional Testing
- •68.2.3 In Vivo Imaging
- •68.3 Results
- •68.3.1 Function
- •68.3.2 Morphology
- •68.4 Discussion
- •References
- •69.1 Introduction
- •69.2 Materials and Methods
- •69.2.1 Mice and Light Exposure
- •69.3 Results
- •69.3.3 Jak3 mRNA Is Induced Similarly in the Model of Light Induced Photoreceptor Cell Death and the rd1 Mouse Model
- •69.4 Discussion
- •References
- •70.1 Introduction
- •70.2 Diseases Associated with RDS Mutations
- •70.3 Current Animal Models
- •70.4 Gene Therapy in rds Models
- •70.5 Viral Gene Therapy Approaches
- •70.6 Non-viral Approaches
- •References
- •71.1 Introduction
- •71.2 Materials and Methods
- •71.2.1 Retinal Stem Cell Isolation and Culture
- •71.2.2 Single Sphere Passaging
- •71.2.3 Bromodeoxyuridine Labeling
- •71.2.4 Retinal Stem Cell Differentiation
- •71.3 Results
- •71.3.2 Retinal Neurosphere Proliferation
- •71.3.3 Differentiation of Retinal Cells Precursors from RSCs
- •71.4 Discussion
- •References
- •72 A Multi-Stage Color Model Revisited: Implications for a Gene Therapy Cure for Red-Green Colorblindness
- •72.1 Introduction
- •72.2 A Brief History of Color Vision Theory
- •72.3 Color Vision from an Evolutionary Perspective
- •References
- •73 Achromatopsia as a Potential Candidate for Gene Therapy
- •73.1 Human Achromatopsia
- •73.1.1 Clinical Manifestations
- •73.1.2 Current Achromatopsia Treatments
- •73.2 Genetics of Human Achromatopsia
- •73.2.1 GNAT2 Achromatopsia
- •73.2.2 CNG Achromatopsia
- •73.2.3 Achromatopsia Gene Therapy
- •73.3 The Mutant Gnat2 Mouse and Gene Therapy
- •73.3.1 The Cnga3 Mutant Mouse and Gene Therapy
- •73.3.2 The Cngb3 Mutant Dog and Gene Therapy
- •73.4 Prospects for Achromatopsia Gene Therapy
- •References
- •74.1 Introduction
- •74.2 Effects of CNTF/LIF on Photoreceptor and Bipolar Neuron Differentiation
- •74.3 Effects of CNTF/LIF on Muller Glia Genesis and Late Progenitor Proliferation
- •74.4 Effects of LIF Misexpression on Retinal Vasculature Development
- •74.5 Expression of CNTF/LIF Signaling Components in the Developing Retina
- •74.6 Signaling Events Triggered by CNTF/LIF During Retinogenesis
- •74.7 CNTF/LIF Regulate Numerous Genes Involved in Retinogenesis
- •74.8 Perspective
- •References
- •75.1 Introduction
- •75.4 Discussion
- •References
- •76.1 The Importance of RPE Cell Function and Integrity for Photoreceptor Survival
- •76.2 The Loss of RPE Cells in Retinal Degeneration
- •76.3 DHA and NPD1 Properties and Neuroprotection
- •References
- •77 Adeno-Associated Virus Serotype-9 Mediated Retinal Outer Plexiform Layer Transduction is Mainly Through the Photoreceptors
- •77.1 Introduction
- •77.2 AAV9-Mediated Gene Transfer in the Retina
- •77.5 Subretinal Injection of AAV9 Vector Did Not Cause Acute Retinal Damage
- •77.6 Conclusions
- •References
- •Index
69 The Differential Role of Jak/Stat Signaling in RD |
603 |
according to the manufacture’s directions including a DNase treatment to digest residual genomic DNA. Equal amounts of RNA were used for reverse transcription using oligo(dT) and M-MLV reverse transcriptase (Promega). Relative quantification of cDNA was carried out by real-time PCR using the LightCycler 480 Sybr Green I Master kit, a LightCycler 480 instrument (Roche) and specific primer pairs (Table 69.1). Three animals per time point were analyzed in duplicates and compared to the expression of the bipolar cell marker visual system homeobox 2 (CHX10) by relative quantification using the Light Cycler 480 software (Roche). CHX10 was chosen because it is expressed in the inner nuclear layer and should not be affected by photoreceptor apoptosis during retinal degeneration. Light exposure samples were normalized to the dark control (DC). Rd1 samples were normalized to the wild-type and to 10 day old rd1 (PND10).
Table 69.1 PCR primers used for real time PCR
Gene |
Upstream |
Downstream |
Product (bp) |
|
|
|
|
Jak1 |
tgagctttgatcggatcctt |
gcagggtcccagaatagatatg |
90 |
Jak2 |
gaacctacagatacggagtgtcc |
caaaatcatgccgccact |
96 |
Jak3 |
cacagtgcatggcctatgat |
aggtgtggggtctgagagg |
110 |
Shp-1 |
tgactaccagagaggtggagaaagg |
agagaccatagacacgctgagtgc |
84 |
STAT1 |
ttgtgttgaatcccgaacct |
tcgaaccactgtgacatcct |
95 |
STAT2 |
attggaagttgcagcgagag |
tgcgccatttggactctt |
67 |
STAT3 |
caaaaccctcaagaagccaagg |
tcactcacaatgcttctccgc |
139 |
STAT4 |
ttcagagcagctcaacatgc |
ggtgaggtgaccatcattgtag |
70 |
STAT5a |
aagatcaagctggggcacta |
catgggacagcggtcatac |
60 |
STAT5b |
cgagctggtctttcaagtca |
ctggctgccgtgaacaat |
64 |
Tyk2 |
cctgtgtcaccttgctctca |
ggaatgagggatgcagttct |
85 |
|
|
|
|
69.3 Results
69.3.1STATs Are Induced Differently in Retinas of Light-Exposed and rd1 Mice
After light exposure STAT1 and STAT2 were induced with peaks at 12–24 h (4- to 5-fold). STAT3 expression was activated earlier with an induction peak at 6–12 h (5- to 7-fold). STAT4 showed only a minor induction at 6–12 h (2-fold) and STAT5a and b did not change in expression (STAT5a) or were slightly downregulated (STAT5b). In the rd1 mouse none of the STATs showed a major differential expression during the degeneration. Only STAT3 was mildly induced at postnatal day 16 (2- to 3-fold). Of note and in contrast to the light-induced model, STAT5b was rather upregulated than downregulated (Table 69.2).
604 |
C. Lange et al. |
Table 69.2 Real time semi-quantitative PCR. Given are means ± standard deviation (SD) of 3 retinas per time-point amplified in duplicates. After light exposure STAT1, 2 and 3 were induced. In the rd1 mouse in contrast there was no induction of STATs. DC: dark control. Im: immediately after light exposure. 6h-30d (light exposure): time-point after light exposure. 10d-37d (rd1): day after birth
|
STAT1 |
STAT2 |
STAT3 |
STAT4 |
STAT5a |
STAT5b |
|
|
|
|
|
|
|
DC |
1.00±0.49 |
1.00±0.20 |
1.00±0.16 |
1.00±0.90 |
1.00±0.23 |
1.00±0.12 |
Im |
0.74±0.27 |
0.93±0.03 |
0.91±0.07 |
0.64±0.44 |
1.03±0.19 |
0.83±0.15 |
6h |
1.96±0.05 |
1.58±0.18 |
6.53±0.81 |
2.13±2.64 |
1.18±0.16 |
0.80±0.13 |
12 h |
4.73±0.28 |
4.51±0.62 |
5.95±1.05 |
2.05±2.49 |
1.09±0.33 |
0.63±0.04 |
24 h |
4.69±0.30 |
4.73±0.66 |
4.28±0.82 |
0.75±0.26 |
1.18±0.12 |
0.63±0.12 |
2d |
1.78±0.31 |
1.16±0.04 |
1.68±0.54 |
0.63±0.36 |
0.92±0.23 |
0.49±0.10 |
3d |
2.27±1.52 |
1.80±0.97 |
1.69±0.61 |
1.05±0.32 |
1.12±0.12 |
0.71±0.21 |
5d |
0.82±0.38 |
0.64±0.21 |
0.76±0.07 |
0.59±0.42 |
0.70±0.06 |
0.59±0.14 |
10d |
0.88±0.16 |
1.02±0.07 |
0.88±0.08 |
0.45±0.11 |
1.10±0.23 |
0.91±0.15 |
20d |
0.61±0.06 |
0.81±0.11 |
0.84±0.03 |
0.77±0.23 |
1.32±0.14 |
0.88±0.08 |
30d |
0.64±0.04 |
0.84±0.11 |
0.75±0.12 |
0.87±0.43 |
1.25±0.26 |
0.87±0.08 |
Rd1 |
1.00±0.00 |
1.00±0.00 |
1.00±0.00 |
1.00±0.00 |
1.00±0.00 |
1.00±0.00 |
10d |
||||||
14d |
0.78±0.34 |
1.04±0.29 |
1.79±0.44 |
0.85±0.24 |
1.38±0.24 |
2.01±0.35 |
16d |
0.81±0.17 |
0.91±0.22 |
2.42±0.11 |
0.57±0.07 |
1.85±0.10 |
1.77±0.11 |
21d |
0.73±0.16 |
0.90±0.16 |
1.45±0.34 |
1.43±0.67 |
1.95±0.29 |
1.97±0.68 |
28d |
0.82±0.23 |
0.80±0.08 |
1.38±0.46 |
0.66±0.13 |
1.51±0.14 |
1.59±0.35 |
37d |
0.56±0.22 |
0.71±0.35 |
1.24±0.54 |
2.37±1.10 |
1.44±0.68 |
1.49±0.70 |
69.3.2Shp-1 Is Induced After Light Exposure But Not in the rd1 Mouse
After light exposure scr-homology containing phosphatase 1 (shp-1) was induced with a peak (7-fold) at 3 days post exposure. In contrast, shp-1 was not induced and showed rather a tendency for downregulation in the rd1 mouse (Table 69.3).
69.3.3Jak3 mRNA Is Induced Similarly in the Model of Light Induced Photoreceptor Cell Death and the rd1 Mouse Model
Jak3 showed an induction with a peak (11-fold) at 24 h after light exposure (Table 69.4). The expression of other Janus kinases remained nearly unchanged. Also in the rd1 mouse induction of Jak3 was prominent at the time of the peak of photoreceptor death (14 days after birth) (5-fold). It stayed induced (2- to 3-fold) at least until all photoreceptors have disappeared (37 days after birth) (Table 69.4). Here the expression of the other Janus kinases tended to be downregulated.
69 The Differential Role of Jak/Stat Signaling in RD
Table 69.3 Real time semi-quantitative PCR for shp-1. Given are means ± standard deviation (SD) of 3 retinas per time-point amplified in duplicates. After light exposure shp-1 was induced. In the rd1 mouse there was no induction of shp-1. DC: dark control. Im: immediately after light exposure. 6h-30d (light exposure): time-point after light exposure. 10d-37d (rd1): day after birth
|
605 |
|
|
|
Shp-1 |
|
|
DC |
1.00±0.41 |
Im |
1.18±0.16 |
6h |
1.63±1.14 |
12 h |
2.14±1.09 |
24 h |
3.17±0.63 |
2d |
4.17±0.84 |
3d |
7.42±1.52 |
5d |
2.17±0.14 |
10d |
2.72±0.72 |
20d |
1.73±0.09 |
30d |
2.12±0.54 |
10d |
1.00±0.03 |
14d |
0.87±0.13 |
16d |
0.52±0.05 |
21d |
0.36±0.01 |
28d |
0.49±0.10 |
37d |
0.14±0.02 |
Table 69.4 Real time semi-quantitative PCR. Given are means ± standard deviation (SD) of 3 retinas per time-point amplified in duplicates. Jak3 was induced in both models. It peaked at 24 h after light exposure and was induced from PND 14 on in the rd1 mouse. DC: dark control. Im: immediately after light exposure. 6h-30d (light exposure): time-point after light exposure. 10d-37d (rd1): day after birth
|
Jak1 |
Jak2 |
Jak3 |
Tyk2 |
|
|
|
|
|
DC |
1.00±0.22 |
1.00±0.09 |
1.00±0.00 |
1.00±0.31 |
Im |
1.05±0.18 |
1.44±0.15 |
0.80±0.06 |
1.42±0.07 |
6h |
1.31±0.09 |
1.79±0.24 |
5.53±0.58 |
1.35±0.14 |
12 h |
1.10±0.32 |
1.45±0.18 |
9.75±1.75 |
1.47±0.11 |
24 h |
0.63±0.07 |
1.18±0.09 |
11.50±2.58 |
1.71±0.30 |
2d |
0.45±0.03 |
0.80±0.04 |
4.07±1.00 |
1.64±0.42 |
3d |
0.59±0.04 |
0.75±0.05 |
4.75±1.17 |
1.61±0.47 |
5d |
0.47±0.09 |
0.83±0.17 |
0.98±0.11 |
0.99±0.35 |
10d |
1.04±0.10 |
0.90±0.23 |
1.34±0.10 |
1.66±0.27 |
20d |
0.67±0.40 |
0.69±0.11 |
1.08±0.10 |
1.32±0.29 |
30d |
0.81±0.13 |
0.74±0.17 |
1.00±0.05 |
1.19±0.21 |
Rd1 |
1.00±0.00 |
1.00±0.09 |
1.00±0.00 |
1.00±0.09 |
10d |
||||
14d |
0.65±0.12 |
0.93±0.18 |
5.33±2.74 |
0.69±0.07 |
16d |
0.43±0.04 |
0.76±0.07 |
5.04±0.53 |
0.67±0.10 |
21d |
0.54±0.02 |
0.72±0.05 |
2.84±0.61 |
0.51±0.01 |
28d |
0.30±0.00 |
0.60±0.06 |
2.35±0.38 |
0.48±0.10 |
37d |
0.21±0.00 |
0.48±0.17 |
3.14±1.54 |
0.31±0.05 |
