Добавил:
kiopkiopkiop18@yandex.ru t.me/Prokururor I Вовсе не секретарь, но почту проверяю Опубликованный материал нарушает ваши авторские права? Сообщите нам.
Вуз: Предмет: Файл:

Ординатура / Офтальмология / Английские материалы / Retinal Degeneration Disease_Hollyfield, Anderson, LaVail_1999

.pdf
Скачиваний:
0
Добавлен:
28.03.2026
Размер:
18.95 Mб
Скачать

8. BIETTI CRYSTALLINE CORNEORETINAL DYSTROPHY

53

6. ACKNOWLEDGMENTS

This study was supported in part by Grant-in Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (Dr Nakamura, C16591746), and Grant-in Aid from the Ministry of Health, Labor, and Welfare of Japan, Tokyo, Japan (Dr. Miyake).

7.REFERENCES

1.Bietti GB. Ueber familiaeres vorkommen von “retinitis punctata albescens” (verbunden mit “dystrophia marginalis cristallinea corneae”), glitzern des glaskoerpers und anderen degenerativen augenveraenderungen. Klin Mbl Augenheilk. 1937;99:737-57.

2.Bagolini B, Ioli-Spada G. Bietti’s tapetoretinal degeneration with marginal corneal dystrophy. Am J Ophthalmol. 1968 Jan;65(1):53-60.

3.Welch RB. Bietti’s tapetoretinal degeneration with marginal corneal dystrophy crystalline retinopathy. Trans Am Ophthalmol Soc. 1977;75:164-79.

4.Yagasaki K, Miyake Y. [Crystalline retinopathy]. Nippon Ganka Gakkai Zasshi. 1986 May;90(5):711-9.

5.Wilson DJ, Weleber RG, Klein ML, Welch RB, Green WR. Bietti’s crystalline dystrophy. A clinicopathologic correlative study. Arch Ophthalmol. 1989 Feb;107(2):213-21.

6.Bernauer W, Daicker B. Bietti’s corneal-retinal dystrophy. A 16-year progression. Retina. 1992;12(1):18-20.

7.Takikawa C, Miyake Y, Yamamoto S. Re-evaluation of crystalline retinopathy based on corneal findings. Folia Ophthalmol Jpn. 1992;43:969-78.

8.Kaiser-Kupfer MI, Chan CC, Markello TC, Crawford MA, Caruso RC, Csaky KG, Guo J, Gahl WA. Clinical biochemical and pathologic correlations in Bietti’s crystalline dystrophy. Am J Ophthalmol. 1994 Nov 15;118(5):569-82.

9.Yanagi Y, Tamaki Y, Takahashi H, Sekine H, Mori M, Hirato T, Okajima O. Clinical and functional findings in crystalline retinopathy. Retina. 2004 Apr;24(2):267-74.

10.Hu DN. Ophthalmic genetics in China. Ophthal Paediat Genet. 1983;2:39-45.

11.Li A, Jiao X, Munier FL, Schorderet DF, Yao W, Iwata F, Hayakawa M, Kanai A, Shy CM, Alan LR, Heckenlively J, Weleber RG, Traboulsi EI, Zhang Q, Xiao X, Kaiser-Kupfer M, Sergeev YV, Hejtmancik JF. Bietti crystalline corneoretinal dystrophy is caused by mutations in the novel gene CYP4V2. Am J Hum Genet. 2004 May;74(5):817-26.

12.Lee J, Jiao X, Hejtmancik JF, Kaiser-Kupfer M, Chader GJ. Identification, isolation, and characterization of a 32-kDa fatty acid-binding protein missing from lymphocytes in humans with Bietti crystalline dystrophy (BCD). Mol Genet Metab. 1998 Oct;65(2):143-54.

13.Lin J, Nishiguchi KM, Nakamura M, Dryja TP, Berson EL, Miyake Y. Recessive mutations in the CYP4V2 gene in East Asian and Middle Eastern patients with Bietti crytalline corneoretinal dystrophy. J Med Genet. (in press)

PART II

DIAGNOSTIC, CLINICAL, CYTOPATHOLOGICAL AND PHYSIOLOGIC ASPECTS OF RETINAL DEGENERATION

CHAPTER 9

FUNDUS APPEARANCE OF CHOROIDEREMIA USING OPTICAL COHERENCE TOMOGRAPY

Bradley J. Katz1, Zhenglin Yang1,2, Marielle Payne1,2, Yin Lin1,2,3,

Yu Zhao1,2, Erik Pearson1,2, Shan Duan1,2, Shin Kamaya1,2,

Goutam Karan1,2, and Kang Zhang1,2

1. INTRODUCTION

Choroideremia is an X-linked recessive disorder characterized by progressive degeneration of the choroid, RPE and retina Goedblood et al., 1942). Patients initially present with night blindness in the first or second decade that progresses to severe constriction of the visual field. Central acuity is lost late in life (Kril et al.).

The initial fundus change is pigment stippling and focal atrophy of the RPE. With time, areas of choroidal atrophy become apparent with exposure of the underlying choroidal vessels. Eventually, only islands of intact retina and choroid remain in the macula and periphery (Kril et al., 1971). Histopathologically there is loss of the outer retinal layers and RPE. Bruch’s membrane may remain, as well as a remnant of the inner retinal layers. Fibrosis of the choroid may also be observed (Rafuse et al., 1968). The pathophysiology of choroideremia is not understood. However, linkage analysis has localized the gene defect to Xq13q22 (Lewis et al., 1985) and the gene has subsequently been cloned (Bokhoven et al., 1994. The protein product of this gene is a Rab escort protein (REP-1) functioning as a RAB geranylgeranyl transferase involved in intracellular vesicular transport (Seabra et al., 1993).

2. PURPOSE

To characterize the appearance of the fundus of a patient with choroideremia using optical coherence tomography (OCT) and identify the underlying gene defect.

1 Moran Eye Center, Department of Ophthalmology and Visual Science, 2 Program in Human Molecular Biology & Genetics, Eccles Institute of Human Genetics, University of Utah, Salt Lake City, UT and 3 Molecular Biology and Genetics, Sichuan Provincial Medical Academy and Sichuan Provincial People’s Hospital, P. R. China.

57

58

B.J. KATZ ET AL.

3. CASE REPORT

A 24-year-old male presented for evaluation of decreased vision. Acuity was 20/25 and visual fields were constricted in each eye. Anterior segments were clear and quiet and intraocular pressures were normal. On fundus examination of both eyes, the optic nerves appeared normal. The retinal arterioles were attenuated. There was an island of intact retina in the center of each macula. The remainder of the fundus was characterized by extensive atrophy of the retina and choriocapillaris with exposure of the underlying large choroidal vasculature (Figures 9.1 and 9.2). A few pigment clumps were seen throughout the fundi.

Figure 9.1. Fundus photographs of the posterior pole, OD (above left) and OS (above right). The retinal arterioles are attenuated. Within the macula, there is an island of normal retina. Surrounding this island there is extensive atrophy with exposure of the underlying choroidal vessels. A few areas of pigment clumping are evident.

Figure 9.2. Fluorescein angiogram of he posterior pole, OD (above left) and OS (above right) at a late phase of angiogram demonstrating extensive atrophy of choriocapillaris and RPE except small islands of remaining retina in the macula and peripapillary regions.

9. FUNDUS APPEARANCE OF CHOROIDEREMIA USING OCT

59

4. RESULTS

Optical coherence tomography through the patient’s optic nerve and macula revealed an abrupt demarcation line between the island of remaining retina within the macula and the surrounding area of chorioretinal atrophy (Figure 9.3). The outer retina and RPE corresponding to the atrophic areas identified by fundus photograghs and fluorescein angiogram were missing. The OCT appearance of the area of chorioretinal atrophy is consistent with previous reports of the histopathology of choroideremia (Figure 9.4).

5. DISCUSSION

We describe the fundus characteristics of choroideremia using OCT. The appearance is consistent with the findings of previous histologic studies. To the best of our knowledge, this is the first report of fundus appearance of choroideremia using OCT. The gene for REP- 1 has been successfully re-introduced in vitro into deficient lymphocytes and fibroblasts with a recombinant adenovirus (Anand et al., 2003) holding open the possibility that treatment of patients with choroideremia may become available in the future. With the use of high resolution OCT, the sub-retina structures can be visualized in a fine detail. OCT will become a valuable tool in monitoring the effect of retina preservation of patients with choroideremia who undergo treatments with gene or drug based therapies.

Figure 9.3. Ocular coherence tomography (OCT) through the optic nerve (arrowheads) and macula of the right eye shows an abrupt demarcation (asterisk) between the island of intact retina and the area of atrophy. The outer retina and RPE are absent, but a thin layer of inner retina and Bruch’s membrane (arrows) are intact within the area of atrophy, consistent with histopathological samples from other patients with choroideremia (Compare to Figure 9.4). Increased signal from the choroid underlying the atrophic area could be consistent with fibrosis of the choroid. See also color insert.

60

B.J. KATZ ET AL.

Figure 9.4. Histopathology of choroideremia in a specimen taken from another patient. There is fibrosis of the choroid and only a single choroidal artery remains. The retinal pigment epithelium and outer nuclear layers are absent. The inner nuclear layer rests against Bruch’s membrane. H&E ¥330. (Reprinted from: Spencer WH, Ophthalmic Pathology, An Atlas and Textbook, 4/e, Figure 9-723, 1997, with permission from Elsevier). See also color insert.

757 C > T (R253X)

CTTCTAATCAAATCTAATGTTAGTTGATATGCAGAGTTTAAAAATATTAC

Figure 9.5. DNA tracing of above patient showing a change at nucleotide position 757 from C to T resulting in the placement of a premature stop codon at amino acid 253.

9. FUNDUS APPEARANCE OF CHOROIDEREMIA USING OCT

61

6. ACKNOWLEDGEMENT

This research was supported by National Institutes of Health Grants R01EY14428, R01EY14448 and GCRC M01-RR00064, the Ruth and Milton Steinbach Fund, Ronald McDonald House Charities, the Macular Vision Research Foundation, the Research to Prevent Blindness, Inc., Knights Templar Eye Research Foundation, American Health Assistance Foundation, the Karl Kirchgessner Foundation, Val and Edith Green Foundation, and the Simmons Foundation, an unrestricted grant to the Department of Ophthalmology and Visual Sciences from Research to Prevent Blindness, Inc., New York, NY.

7. REFERENCES

Anand, V., Barral, D. C., Zeng, Y., et al., 2003, Gene therapy for choroideremia: in vitro rescue mediated by recombinant adenovirus, Vision Res 43:919-926.

Goedblood, J., 1942, Mode of Inheritance in Choroideremia, International Journal of Ophthalmology 104:309315.

Krill A. E., Archer D., 1971, Classification of the choroidal atrophies, Am J Ophthalmol 72(3):562-585.

Lewis, R. A., Nussbaum, R. L., Ferrell, R., 1985, Mapping X-linked ophthalmic diseases. Provisional assignment of the locus for choroideremia to Xq13-q24, Ophthalmology 92:800-806.

Rafuse E. V., McCulloch, C., 1968, Choroideremia: A pathological report, Can J Ophthalmol 3:347-352. Seabra, M C., Brown, M S., Goldstein, J L., 1993, Retinal degeneration in choroideremia: deficiency of rab ger-

anylgeranyl transferase, Science, 259:377-381

van Bokhoven, H., van den Hurk, J. A., Bogerd, L., et al., 1994, Cloning and characterization of the human choroideremia gene, Hum Mol Genet 3:1041-1046.

CHAPTER 10

A2E, A FLUOROPHORE OF RPE LIPOFUSCIN, CAN DESTABILIZE MEMBRANE

Janet R. Sparrow, Bolin Cai, Young Pyo Jang, Jilin Zhou, and Koji Nakanishi*

1. INTRODUCTION

Studies of Stargardt disease suggest a role for RPE lipofuscin in the RPE cell atrophy that characterizes macular degeneration. The best known constituent of RPE lipofuscin is the pyridinium bisretinoid, A2E (Eldred and Lasky, 1993; Parish et al., 1998). Amongst the properties of A2E that may be damaging to the RPE cell is its ability to destabilize cell membranes (Sparrow et al., 1999). A hydrophilic head group combined with a pair of hydrophobic side-arms are the structural correlates of this behavior. This amphiphilic structure accounts for the tendency of A2E to aggregate (Sakai et al., 1996; De and Sakmar, 2002), a behavior first recognized in deuterated chloroform (CDCl3), the broadening of the 1H NMR signal indicating that the protonated pyridinium moieties of A2E were closely packed within the interior of micelles while the hydrophobic chains contacted the solvent. Further evidence of the detergent-like behaviour of A2E has been revealed in experiments demonstrating the ability of A2E to induce concentration-dependent membrane leakage (Sparrow et al., 1999). In studies employing unilamellar vesicles, it has also been shown that A2E, at critical micellar concentrations, can solubilize membranes (De and Sakmar, 2002).

In an effort to further our understanding of the ability of A2E to alter membrane integrity, we developed an experimental paradigm for the detection of membrane blebbing using ARPE-19 cells transduced to express wild-type green fluorescent protein. In addition, we compared the behavior of A2E to the mono-retinoid, A1E, a single sidearm counterpart to A2E. Here we report the results of these studies.

2. METHODS

ARPE-19 cells, A1E and A2E. A human RPE cell line (ARPE-19) was grown as formerly described. A2E and A1E were synthesized using published methods (Parish et al.,

* Departments of Ophthalmology and Chemistry, Columbia University, New York, NY 10032.

63

64

J.R. SPARROW ET AL.

1998; Jockusch et al., 2004) and were incubated with cells as previously reported (Sparrow et al., 2000). For the imaging of A2E and A1E accumulation by epifluorescence microscopy, the filters and dichroic mirror utilized permitted 330 ± 80 nm excitation and >400 nm emission. For laser scanning confocal microscopy, cell borders were defined by immunolabeling with rabbit antibody to human ZO-1 (Zymed Laboratories, South San Francisco CA) and TRITC-labeled donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA). Nuclei were stained with propidium iodide (Molecular Probes, Eugene OR) and A1E was visualized with fluorescein-appropriate filters so that its fluorescence appeared green, in contrast with the cell borders and nuclei.

GFP-expressing ARPE-19 cells. A lentivirus-based vector (CMV promotor and VSV- G envelope protein) was used to transfer the gene for wild-type green fluorescent protein (GFP) (Lai et al., 1999) to ARPE-19 cells. For viral transduction the cells were grown to 70-80% confluence and were then incubated with GFP-expressing lentivirus (105-107 transducing units) in serum free medium. After 24 hours the infection medium was replaced with normal growth medium and maintained for 4 days. The transfected cells were then replated in eight-well plastic chamber slides (LabTek; Nunc, Naperville, IL) and at subconfluent cell densities, synthesized A2E was added to the cells at concentrations of 20 and 100 mM.

Assays of cell permeability. To assay membrane integrity, cultures were incubated with the membrane impermeable dye Dead Red (Molecular Probe, Eugene OR) (Sparrow et al., 1999) and postfixation, were stained with DAPI (6-diamidino-2-phenylindole). Release of the cytoplasmic enzyme lactate dehydrogenase (LDH) into culture media was measured as previously described (Sparrow et al., 1999).

3. RESULTS

A2E-induced membrane blebbing is indicative of the ability of this fluorophore to perturb membrane. To test for evidence that A2E can induce membrane blebbing, we employed the plasma membrane of ARPE-19 cells as a model membrane bilayer and labeled the cytosol by transducing the cells to express wild-type GFP. The cells were then exposed to exogenous A2E at concentrations of 20 mM and 100 mM for 3-4 hours. As shown in Fig. 10.1, GFP-filled membrane blebs formed on A2E-treated but not control cells. The effect was also concentration-dependent with blebbing occurring at 100 mM but not 20 mM A2E. The DAPI-stained nuclei of many of the cells exhibiting membrane blebs were not colabeled with a membrane impermeable dye (Dead Red; Molecular Probes). Exclusion of the dye indicates that, at least during the early stages of membrane blebbing, the cells retained normal membrane impermeability.

The wedge-shaped structure of A2E influences its ability to penetrate and perturb cell membranes. To begin to understand how the structure of A2E determines the manner in which it interacts with membranes, we designed and synthesized A1E [molecular weight (mw) 352.7; UV lmax 411 and 248 nm], a mono-retinoid single side arm counterpart to A2E that is not naturally occurring (Fig. 10.2). Like A2E and iso-A2E (mw 592; UV lmax 430 and 335 nm), this compound presents with a positively charged pyridine ring and retains both hydrophobic and hydrophilic elements. Just as A2E is amassed by cells in culture (Sparrow et al., 1999), it was evident by confocal microscopy that A1E accumulates in cells (Fig. 10.3). However, A1E accumulation occurred more rapidly. For instance, when we incubated cells with either A2E or A1E at 20 mM for 2 days, A1E fluorescence was readily appar-

10. A2E AND RPE DEGENERATION

65

Figure 10.1. A2E induces membrane blebbing. Concentration dependent-bleb formation is visualized in nonconfluent ARPE-19 cells transduced to express cytoplasmically-located wild-type green fluorescent protein (GFP) (A–C). At the time of bleb formation (C,D), many of the cells maintain membrane impermeability as evidenced by the absence of nuclear labeling by a membrane impermeable dye (E). The nuclei of the cells are visualized with DAPI (F).

Figure 10.2. Structures of A2E, the photoisomer iso-A2E and the non-biological compound A1E.

ent in the cells, but no A2E fluorescence was yet visible (Fig. 10.4A). Within this 2 day interval, 20 mM A1E, but not A2E, also induced membrane permeabilization (Fig. 10.4B).

Rapid membrane permeabilization induced by A1E was also demonstrated by assaying for the release of cytoplasmic LDH into the culture medium. Thus when cells were incubated with A1E for 2 hours, LDH levels in culture supernatants increased in a concentra- tion-dependent manner. However, although A2E is well known to cause membrane permeabilization (Sparrow et al., 1999), a 2 hour incubation in A2E was not of sufficient duration to elicit a detectable increase in LDH-associated absorbance in the media.