Ординатура / Офтальмология / Английские материалы / Retinal Degeneration Disease_Hollyfield, Anderson, LaVail_1999
.pdf
32 |
Z.-B. JIN ET AL. |
Figure 5.2. The novel deletion spans 30204 base pairs absence of exon 1 to exon 11. The dashed line indicates the deletion. The mutant allele sequence is shown at the bottom, and the arrowhead indicates the break point.
RCC1-like domain play a crucial role in the human retina. Further studies on the role of the RCC1-like domain in the visual Cascade and additional findings of related proteins in the retina or even other organs, will give us a more precise understanding of this protein.
5.REFERENCES
1.Fishman GA, 1978, Retinitis pigmentosa. Genetic percentages. Arch Ophthalmol, 96:1185-1188.
2.Boughman JA, Conneally PM, Nance WE, 1980, Population genetic studies of retinitis pigmentosa. Am J Hum Genet, 32:223-235.
3.Jay M, 1982, Figures and fantasies: the frequencies of the different genetic forms of retinitis pigmentosa. Birth Defects Orig Artic Ser, 18:167-173.
4.Bunker CH, Berson EL, Bromley WC, Hayes RP, Roderick TH, 1984, Prevalence of retinitis pigmentosa in Maine. Am J Ophthalmol, 97:357-365.
5.Musarella MA, nson-Cartwright L, Leal SM, Gilbert LD, Worton RG, Fishman GA, Ott J, 1990, Multipoint linkage analysis and heterogeneity testing in 20 X-linked retinitis pigmentosa families. Genomics, 8:286-296.
6.Ott J, Bhattacharya S, Chen JD, Denton MJ, Donald J, Dubay C, Farrar GJ, Fishman GA, Frey D, Gal A, 1990, Localizing multiple X chromosome-linked retinitis pigmentosa loci using multilocus homogeneity tests. Proc Natl Acad Sci U S A, 87:701-704.
7.Teague PW, Aldred MA, Jay M, Dempster M, Harrison C, Carothers AD, Hardwick LJ, Evans HJ, Strain L, Brock DJ, 1994, Heterogeneity analysis in 40 X-linked retinitis pigmentosa families. Am J Hum Genet, 55:105111.
8.Bergen AA, Van den Born LI, Schuurman EJ, Pinckers AJ, Van Ommen GJ, Bleekers-Wagemakers EM, Sandkuijl LA, 1995, Multipoint linkage analysis and homogeneity tests in 15 Dutch X-linked retinitis pigmentosa families. Ophthalmic Genet, 16:63-70.
9.Fujita R, Buraczynska M, Gieser L, Wu W, Forsythe P, Abrahamson M, Jacobson SG, Sieving PA, Andreasson S, Swaroop A, 1997, Analysis of the RPGR gene in 11 pedigrees with the retinitis pigmentosa type 3 genotype: paucity of mutations in the coding region but splice defects in two families. Am J Hum Genet, 61:571-580.
10.Meindl A, Dry K, Herrmann K, Manson F, Ciccodicola A, Edgar A, Carvalho MR, Achatz H, Hellebrand H, Lennon A, Migliaccio C, Porter K, Zrenner E, Bird A, Jay M, Lorenz B, Wittwer B, D’Urso M, Meitinger T,
5. RCC1-LIKE DOMAIN AND ORF15: ESSENTIALS IN RPGR GENE |
33 |
Wright A, 1996, A gene (RPGR) with homology to the RCC1 guanine nucleotide exchange factor is mutated in X-linked retinitis pigmentosa (RP3). Nature Genetics, 13:35-42.
11.Roepman R, Bauer D, Rosenberg T, van Duijnhoven G, van de Vosse E, Platzer M, Rosenthal A, Ropers H, Cremers F, Berger W, 1996, Identification of a gene disrupted by a microdeletion in a patient with X-linked retinitis pigmentosa (XLRP). Hum Mol Genet, 5:827-833.
12.Schwahn U, Lenzner S, Dong J, Feil S, Hinzmann B, van DG, Kirschner R, Hemberger M, Bergen AA, Rosenberg T, Pinckers AJ, Fundele R, Rosenthal A, Cremers FP, Ropers HH, Berger W, 1998, Positional cloning of the gene for X-linked retinitis pigmentosa 2. Nat Genet, 19:327-332.
13.Vervoort R, Lennon A, Bird AC, Tulloch B, Axton R, Miano MG, Meindl A, Meitinger T, Ciccodicola A, Wright AF, 2000, Mutational hot spot within a new RPGR exon in X-linked retinitis, pigmentosa. Nature Genetics, 25:462-466.
14.Breuer DK, Yashar BM, Filippova E, Hiriyanna S, Lyons RH, Mears AJ, Asaye B, Acar C, Vervoort R, Wright AF, Musarella MA, Wheeler P, MacDonald I, Iannaccone A, Birch D, Hoffman DR, Fishman GA, Heckenlively JR, Jacobson SG, Sieving PA, Swaroop A, 2002, A Comprehensive Mutation Analysis of RP2 and RPGR in a North American Cohort of Families with X-Linked Retinitis Pigmentosa. Am J Hum Genet, 70:1545-1554.
15.Gorlich D, Mattaj IW, 1996, Nucleocytoplasmic Transport. Science, 271:1513-1519.
16.Linari M, Ueffing M, Manson F, Wright A, Meitinger T, Becker J, 1999, The retinitis pigmentosa GTPase regulator, RPGR, interacts with the delta subunit of rod cyclic GMP phosphodiesterase. PNAS, 96:1315-1320.
17.Hong D-H, Yue G, Adamian M, Li T, 2001, Retinitis Pigmentosa GTPase Regulator (RPGR)-interacting Protein Is Stably Associated with the Photoreceptor Ciliary Axoneme and Anchors RPGR to the Connecting Cilium. J Biol Chem, 276:12091-12099.
18.Boylan JP, Wright AF, 2000, Identification of a novel protein interacting with RPGR. Hum Mol Genet, 9:20852093.
19.Musarella MA, nson-Cartwright L, Leal SM, Gilbert LD, Worton RG, Fishman GA, Ott J, 1990, Multipoint linkage analysis and heterogeneity testing in 20 X-linked retinitis pigmentosa families. Genomics, 8:286-296.
20.Ott J, Bhattacharya S, Chen JD, Denton MJ, Donald J, Dubay C, Farrar GJ, Fishman GA, Frey D, Gal A, 1990, Localizing multiple X chromosome-linked retinitis pigmentosa loci using multilocus homogeneity tests. Proc Natl Acad Sci U S A, 87:701-704.
21.Teague PW, Aldred MA, Jay M, Dempster M, Harrison C, Carothers AD, Hardwick LJ, Evans HJ, Strain L, Brock DJ, 1994, Heterogeneity analysis in 40 X-linked retinitis pigmentosa families. Am J Hum Genet, 55:105111.
22.Bergen AA, Van den Born LI, Schuurman EJ, Pinckers AJ, Van Ommen GJ, Bleekers-Wagemakers EM, Sandkuijl LA, 1995, Multipoint linkage analysis and homogeneity tests in 15 Dutch X-linked retinitis pigmentosa families. Ophthalmic Genet, 16:63-70.
23.Fujita R, Buraczynska M, Gieser L, Wu W, Forsythe P, Abrahamson M, Jacobson SG, Sieving PA, Andreasson S, Swaroop A, 1997, Analysis of the RPGR gene in 11 pedigrees with the retinitis pigmentosa type 3 genotype: paucity of mutations in the coding region but splice defects in two families. Am J Hum Genet, 61:571-580.
24.Sharon D, Sandberg MA, Rabe VW, Stillberger M, Dryja TP, Berson EL, 2003, RP2 and RPGR Mutations and Clinical Correlations in Patients with X-Linked Retinitis Pigmentosa. American Journal of Human Genetics, 73:1131-1146.
25.Hong D-H, Pawlyk BS, Shang J, Sandberg MA, Berson EL, Li T, 2000, A retinitis pigmentosa GTPase regulator (RPGR)- deficient mouse model for X-linked retinitis pigmentosa (RP3). PNAS, 97:3649-3654.
26.Buraczynska M, WWFRBKPEASBJBDFGHDIGJSMMSPSA, 1997, Spectrum of mutations in the RPGR gene that are identified in 20% of families with X-linked retinitis pigmentosa. Am J Hum Genet, 61:12871292.
27.Andreasson S, PVAMEBWWFRBMSA, 1997, Phenotypes in three Swedish families with X-linked retinitis pigmentosa caused by different mutations in the RPGR gene. Am J Ophthalmol, 124:95-102.
28.Kirschner R, Rosenberg T, Schultz-Heienbrok R, Lenzner S, Feil S, Roepman R, Cremers F, Ropers H, Berger W, 1999, RPGR transcription studies in mouse and human tissues reveal a retinaspecific isoform that is disrupted in a patient with X-linked retinitis pigmentosa. Hum Mol Genet, 8:1571-1578.
CHAPTER 6
CHOROIDAL NEOVASCULARIZATION IN PATIENTS WITH ADULT-ONSET FOVEOMACULAR DYSTROPHY CAUSED BY MUTATIONS IN THE
RDS/PERIPHERIN GENE
Darius M. Moshfeghi1, Zhenglin Yang2, Nathan D. Faulkner2,
Goutam Karan2, Sukanya Thirumalaichary2, Erik Pearson2, Yu Zhao2,
Thomas Tsai3, and Kang Zhang2
1. INTRODUCTION
Adult-onset foveomacular dystrophy (AOFMD) was first described as a peculiar foveomacular dystrophy in 1974 (Gass, 1974). A mutation in the RDS/peripherin gene (Pro-210- Arg) was identified in this particular kindred (Gorin et al., 1994). Subsequently, Feist and coworkers reported a case of choroidal neovascularization associated with AOFMD in a patient with the Pro-210-Arg mutation (Feist et al., 1994). To our knowledge, CNV in AOFMD is rare as demonstrated by only two other descriptions of it in the literature: 1) Vine and Schatz described three instances in two patients, neither of whom had an identified mutation (Vine et al., 1980); and 2) Battaglia Parodi and coworkers described a case of subfoveal CNV in a vascularized pigment epithelial detachment in a patient with AOFMD (Battaglia et al., 2000). Recently, an A to G change, predicting a Tyr-141-Cys substitution in the RDS/peripherin gene has been described that results in AOFMD which is dominantly transmitted (Yang et al., 2004). In addition, a frameshift mutation in exon 1 of the RDS/peripherin gene, that results in a guanine deletion at nucleotide position 112, leads to a premature termination of the gene product at amino acid 38 and has been implicated in the genesis of AOFMD in a 13-family member kindred (Yang et al., 2003). We present three cases of subfoveal CNV in patients with AOFMD, which were caused by RDS/peripherin gene mutations.
1 Department of Ophthalmology, Stanford University Head of Ophthalmic Oncology, 2 Moran Eye Center, Department of Ophthalmology and Visual Science, and Program in Human Molecular Biology & Genetics, Eccles Institute of Human Genetics, University of Utah, Salt Lake City, UT, 3 Ohio Retinal Associates, Parma, OH.
35
36 |
D.M. MOSHFEGHI ET AL. |
2. METHODS
Patients with AOFMD and CNV underwent ophthalmoscopic examination and fluorescein angiography. They also donated peripheral venous blood and underwent mutational screening to detect RDS/peripherin gene mutations using standard techniques (Zhang et al., 2001).
3. RESULTS
3.1. Case 1
A 68-year-old Caucasian female presented to an outside ophthalmologist with a complaint of diminished visual acuity in her right eye. Her best-corrected visual acuity was 20/40 OD and 20/20- OS. Slit-lamp biomicroscopy demonstrated mild pseudophakic bullous keratopathy changes and posterior chamber intraocular lenses in each eye. She had a central distortion on Amsler grid testing in her right eye. Dilated fundus examination revealed a subfoveal choroidal neovascularization (CNV) with surrounding hemorrhage and lipid in the right eye (Figure 6.1A) and geographic atrophy with retinal pigment epithelial mottling in the left eye (Figure 6.1B). Fluorescein angiography demonstrated subfoveal CNV with a predominantly classic pattern (Figure 6.1C,D). She was offered verteporfin OPT and underwent treatment at that time. On two subsequent three month follow-up exams, her visual acuity was stable at 20/40 OD, and her fluorescein angiogram demonstrated mild leakage (Figure 6.1E,F). She underwent repeat verteporfin OPT at those visits. A family history survey revealed that she belonged to a family with nine relatives diagnosed with AOFMD transmitted in an autosomal dominant pattern. DNA analyses showed that all affected individuals in this family inherited a Tyr-141-Cys mutation. She has had no evidence of recurrence of her CNV either by fundus examination or as demonstrated by leakage on fluorescein angiography (data not shown), and her vision has remained stable at 20/40 OD.
3.2. Case 2
An 80-year-old Caucasian female presented to an outside ophthalmologist with a complaint of diminished visual acuity in the right eye. Her best-corrected visual acuity was 20/60-2 OD and 20/100+ OS. Slit-lamp biomicroscopy demonstrated 1+ cortical changes and nuclear sclerosis in each eye. She had a central distortion on Amsler grid testing in her right eye. Dilated fundus examination revealed a subfoveal choroidal neovascularization with surrounding hemorrhage and lipid in the right eye (Figure 6.2A) and geographic atrophy involving the center of the macula of the left eye (Figure 6.2B). Fluorescein angiography demonstrated a minimally classic, subfoveal CNV (Figure 6.2C,D). She has been observed for over 1 year without change in her visual status.
3.3. Case 3
A 53-year-old Caucasian female (daughter of Case 2) presented with a complaint of diminished visual acuity in her right eye. She had previously undergone laser photocoagu-
6. CNV CAUSED BY MUTATIONS IN THE RDS/PERIPHERIN GENE |
37 |
Figure 6.1. Case 1. A 68-year-old Caucasian female with adult-onset foveomacular dystrophy. Note the choroidal neovascularization in the right eye with surrounding lipid and hemorrhage (Figure 6.1A). The left fundus demonstrates a central area of retinal pigment epithelial atrophy (Figure 6.1B). Early fluorescein angiogram of the right eye demonstrates a predominantly classic, subfoveal choroidal neovascular membrane with surrounding blocking defect from hemorrhage (Figure 6.1C). On late frames, there is extensive fluorescein leakage (Figure 6.1D). Six months after PDT treatment, the right eye demonstrates early hyperfluorescence (Figure 6.1E) with mild late leakage (Figure 6.1F).
lation for a subfoveal choroidal neovascular membrane in her left eye two years earlier. Her best-corrected visual acuity was 20/30- OD and 20/400 OS. Slit-lamp biomicroscopy demonstrated 1+ nuclear sclerosis in each eye. She had a central distortion on Amsler grid testing in the right eye and a large central scotoma in the left eye. Dilated fundus examination revealed a subfoveal choroidal neovascularization with surrounding hemorrhage and lipid in the right eye (Figure 6.3A) and a laser photocoagulation scar involving the center of the macula of the left eye (Figure 6.3B). Fluorescein angiography demonstrated a fibrovascular pigment epithelial detachment involving the fovea of the right eye (Figure 6.3C,D). She has been observed for 12 months without change in her visual status.
38 |
D.M. MOSHFEGHI ET AL. |
Figure 6.2. Case 2. An 80-year-old Caucasian female with adult-onset foveomacular dystrophy. In the right eye there is a choroidal neovascular membrane juxtafoveally situated with hemorrhage, elevation of the retinal pigment epithelium (RPE), and lipid exudation (Figure 6.2A). The left eye demonstrated RPE atrophy as well as subretinal yellow deposits (Figure 6.2B). Fluorescein angiogram of the right eye showed patchy early fluorescence with blocking defect corresponding to areas of hemorrhage (Figure 6.2C), as well as intense hyperflourescence and late staining (Figure 6.2D).
Figure 6.3. Case 3. A 53-year-old Caucasian female with adult-onset foveomacular dystrophy (daughter of case 2). Fundus examination of the right eye showed diffuse elevation of the RPE with gray coloring and a hyperpigmented spot (Figure 6.3A). Examination of the left eye demonstrated a previous laser photocoagulation scar with RPE hyperplasia, temporal RPE atrophy, and fibrosis overlying the fovea (Figure 6.3B). Fluorescein angiogram in the right eye demonstrated patchy, granular early hyperfluorescence (Figure 6.3C), that hyperfluoresced and stained intensely in late frames (Figure 6.3D).
6. CNV CAUSED BY MUTATIONS IN THE RDS/PERIPHERIN GENE |
39 |
4. DISCUSSION
This case series describes 3 patients with AOFMD, subfoveal CNV, and a mutation of the RDS/Peripherin gene. One patient had a Tyr-140-Cys substitution in the RDS/ Peripherin gene and two patients (mother and daughter) had a single guanine base deletion at position 112 of the RDS/Peripherin gene. The Tyr-141-Cys mutation is seen with both butterfly-shaped pattern dystrophy and AOFMD, and is associated with moderate visual loss (Yang, 2004). The guanine base deletion at position 112 is associated with advanced macular degeneration and poor visual acuity (Payne, 2004). One patient was successfully treated with a course of verteporfin OPT, with stabilization of visual acuity in the treated eye. This represents the first documented case of a choroidal neovascular membrane secondary to a known genetic mutation treated with photodynamic therapy. The remaining two patients have been observed for over a year without precipitous decline in visual acuity.
5. CONCLUSION
Further understanding of genotype/phenotype correlations between the mutations of the RDS/peripherin gene and CNV due to AOFMD may be useful to provide prognostic information and determine which patients with AOFMD and subfoveal CNV may be candidates for treatment.
6. ACKNOWLEDGEMENTS
This research was supported by National Institutes of Health Grants R01EY14428, R01EY14448 and GCRC M01-RR00064, the Ruth and Milton Steinbach Fund, Ronald McDonald House Charities, the Macular Vision Research Foundation, the Research to Prevent Blindness, Inc., Knights Templar Eye Research Foundation, Grant Ritter Fund, American Health Assistance Foundation, the Karl Kirchgessner Foundation, Val and Edith Green Foundation, and the Simmons Foundation.
7. REFERENCES
Gass, J. D. M., 1974, A clinicopathologic study of a peculiar foveomacular dystrophy, Trans Am Ophthalmol Soc. 72:139-156.
Vine, A. K., Schatz, H., 1980, Adult-onset foveomacular pigment epithelial dystrophy, Am J Ophthalmol. 89:680691.
Gorin, M. B., Jackson, K. E., Ferrell, O. D., et al., 1994, A peripherin/retinal degeneration slow mutation (Pro-210-Arg) associated with macular and peripheral retinal degeneration, Ophthalmology 102:246-255.
Feist, R. M., White, M. F., Skalka, H., Stone, E. M., 1994, Choroidal neovascularization in a patient with adult foveomacular dystrophy and a mutation in the retinal degeneration slow gene (Pro 210 Arg), Am J Ophthalmol. 118:259-260.
Battaglia, P. M., Di Crecchio, L., Ravalico, G., 2000, Vascularized pigment epithelial detachment in adult-onset foveomacular vitelliform dystrophy, Eur J Ophthalmol. 10:266-269.
Zhang, K., et al., 2001, A 5-bp deletion in ELOVL4 is associated with two related forms of autosomal dominant macular dystrophy, Nat Genet. 27(1):89-93.
40 |
D.M. MOSHFEGHI ET AL. |
Yang, Z., et al., 2003, A novel mutation in the RDS/Peripherin gene causes Adult-onset Foveomacular Dystrophy,
Am. J. Ophthalmol. 135:213-218.
Yang, Z., Jiang, L., Karan, G., Moshfeghi, D., O’Connor, S. Z., Lewis, H., Zack, D., Jacobsen, S., Zhang, K., 2004, A novel RDS/peripherin gene mutation associated with diverse macular phenotypes, Ophthalmic Genet. 25(2):133-145.
Payne, M., et al., 2004, Dominant optic atrophy, sensorineural hearing loss, ptosis, and ophthalmoplegia: a syndrome caused by a missense mutation in OPA1, Am. J. Ophthalmol. 138(5):749-755.
CHAPTER 7
BIOCHEMICAL CHARACTERISATION OF THE C1QTNF5 GENE ASSOCIATED WITH LATE-ONSET RETINAL DEGENERATION
A genetic model of age-related macular degeneration
Xinhua Shu1, Brian Tulloch1, Alan Lennon1, Caroline Hayward1,
Mary O’Connell1, Artur V. Cideciyan2, Samuel G. Jacobson2, and
Alan F. Wright1,*
1. INTRODUCTION
Age-related macular degeneration (AMD) is the commonest cause of severe vision loss in adults, affecting up to 30% of the elderly population and accounting for 50-60% of new blind registration in western countries (Green and Enger, 1993; Seddon, 2001). It is characterised by a late-onset degeneration of the retinal macula and represents the advanced stage of a more common disorder, age-related maculopathy. There are two clinical subtypes of AMD, one is a “dry” form characterised by geographic atrophy, the other a “wet” form characterised by choroidal neovascularisation (CNV). This “wet” form represents only 10% of cases but accounts for about 90% of registered blindness (Ferris et al., 1984). The important early pathological features of AMD are the presence of both focal (drusen) and diffuse extracellular (basal) deposits in the macula, between the retinal pigment epithelium (RPE) and inner collagenous layer of Bruch’s membrane, a pentalaminar structure bounded by the basement membranes of RPE and choroidal capillary 1endothelium. These deposits lead to dysfunction and later death of RPE and associated photoreceptors. The nature of the proteins within the diffuse extracellular deposits have not been elucidated but the focal deposits (drusen) include >100 proteins, together with esterified and non-esterified cholesterol and other lipids and glycosaminoglycans (Crabb et al., 2002; Malek et al., 2003). Risk factors for AMD include age, sex, family history, APOE genotype, smoking, ethnicity and cardio-
1 MRC Human Genetics Unit, Western General Hospital, Edinburgh, UK; 2 Department of Ophthalmology, Scheie Eye Institute, University of Pennsylvania, Philadelphia, PA, USA. * Corresponding author: Alan Wright, E-mail: alan.wright@hgu.mrc.ac.uk.
41
42 |
X. SHU ET AL. |
vascular disease (Seddon, 2001). Genetic factors are implicated in AMD on the basis of twin and family studies but it appears to be a genetically complex disorder (Hammond et al., 2002).
An important means of elucidating diseases mechanism in genetically complex disorders such as AMD, is to take advantage of information from simple, often rare genetic abnormalities associated with these disorders. Late-onset retinal degeneration (L-ORD) is a rare autosomal dominant disorder characterised by onset in the fifth to sixth decade with punctate drusen-like deposits in the posterior pole of the retinal fundus, followed by macular degeneration and a diffuse chorioretinal atrophy with, in late stages, CNV and disciform scarring (Jacobson et al., 2001; Kuntz et al., 1996; Milam et al., 2000). A major and probably feature of the disease is a thick extracellular sub-RPE deposit similar to, but more extensive than that seen in AMD (Kuntz et al., 1996; Milam et al., 2000). This disorder is an excellent model for the most severe “wet” form of AMD. The causal gene in L-ORD was identified by positional cloning, which identified a Ser163Arg mutation in the C1QTNF5 short-chain collagen gene in affected members of 7 out of 14 L-ORD families, suggesting genetic heterogeneity (Hayward et al., 2003). The C1QTNF5 gene is strongly expressed in RPE cells and may be involved with adhesion between RPE and Bruch’s membrane. The protein is predicted to contain an N-terminal secretory signal, a short helical collagen repeat and a C-terminal globular complement 1q (gC1q) domain concerned with trimerisation. The functional consequences of the Ser163Arg mutation in the gC1q domain appear to be destabilisation and aggregation of the protein as a result of an abnormal surface charge (Hayward et al., 2003). To better understand the function of C1QTNF5, we investigated the biochemical properties of its gC1q domain and found that the native protein is capable of oligomerisation into both trimeric and hexameric forms which are unstable under denaturing conditions.
2. MATERIALS AND METHODS
2.1. Preparation of C1QTNF5 gC1q Domain Constructs
C1QTNF5 gC1q domain was cloned by amplification using primers C1q N1:-5¢-GTGC- CTCCGCGATCCGCCTTC - and C1q C1:-5¢-AGCAAAGACTGGGGAGCTGTGCCA - using Human Retina Marathon-Ready cDNA (Clontech) as template. The amplification was carried out using Expand High Fidelity PRC System (Roche) with cycling conditions of 95°C for 30 sec, 56°C for 1 min and 72°C for 30 sec over 35 cycles. The amplified fragment was purified and ligated into pBAD/TOPO ThioFusion vector (Invitrogen). Positive clones were plasmid-purified and sequenced to determine the correct orientation of the insert. To construct the C1QTNF5 gC1q Ser163Arg mutant, one PCR was carried using primers C1q N1 and C1qmut C1:-5¢-CAGATCAAACTGCAGCCTGGCCCGGTAGACGGT.
The second PCR was carried out using primer C1qmut N1:-5¢-ACCGTCTAC CGGGCCAGGCTGCAGTTTGATCTG - and C1q C1, the two reactions used Human Retina Marathon-Ready cDNA (Clontech) as templates. The two PCR products were purified, mixed and used as template in the overlapping PCR with primers C1q N1 and C1q C1. The conditions of the three separate PCR were as mentioned above. The recombinant mutant PCR fragment was purified and ligated into the pBAD/TOPO ThioFusion vector