Добавил:
kiopkiopkiop18@yandex.ru t.me/Prokururor I Вовсе не секретарь, но почту проверяю Опубликованный материал нарушает ваши авторские права? Сообщите нам.
Вуз: Предмет: Файл:
Ординатура / Офтальмология / Английские материалы / Myopia Animal Models to Clinical Trials_Beuerman, Saw, Tan_2009.pdf
Скачиваний:
0
Добавлен:
28.03.2026
Размер:
3.4 Mб
Скачать

349 Atropine and Other Pharmacological Approaches to Prevent Myopia

myopia development.37 The rationale for the use of ocular hypotensives was that raised intraocular pressure may exert a passive stretching effect on the sclera of the eye, contributing to axial elongation. However, there is little evidence that supports this in the scientific literature.

Efficacy Studies

A parallel group randomized controlled study in Taiwan has shown the efficacy of atropine in the retardation of myopia.16 This study, however, is not masked. Another study in Taiwan has38 evaluated the use of various concentrations of atropine (0.5%, 0.25% and 0.1%) in myopia. A study in Singapore has found 1% atropine to be efficacious in the retardation of childhood myopia.19 Three hundred forty-six (86.5%) children completed the 2-year study. After 2 years, the mean progression of myopia and of axial elongation in the placebo-treated control eyes was 1.20+/−0.69 D and 0.38+/−0.38 mm, respectively. In the atropine-treated eyes, myopia progression was only 0.28+/−0.92 D, whereas the axial length remained essentially unchanged as compared with the baseline (0.02+/−0.35 mm). The differences in myopia progression and axial elongation between the two groups were 0.92 D (95% confidence interval, 1.10 to 0.77 D; p < 0.001) and 0.40 mm (95% confidence interval, 0.35–0.45 mm; p < 0.001), respectively.

Despite the efficacy results of the studies employing atropine eyedrops, numerous questions remain. One aspect that needs to be addressed is the effect of stopping atropine eye drops. The results of the above study in Singapore show that on stopping atropine after two years of administration, the progression rate of myopia increased in the subsequent year, as compared with children who had placebo in the first two years.20 In the year after cessation of drugs, the mean progression rate in the atropine group was –1.14+/−0.80 D, whereas the placebo group only progressed by –0.38+/− 0.39 D (p < 0.0001). However, a beneficial effect was still evident in the atropine group over the course of three years in the clinical trial. At the end of three years, the spherical equivalent in the atropine group was –4.29+/–1.67 D as compared with –5.22+/−1.38 D in the placebo group (p < 0.0001). Importantly, after the cessation of atropine, the amplitude of accommodation and near visual acuity, previously impaired, returned to pretreatment levels.

350 L.M.G. Tong, V.A. Barathi and R.W. Beuerman

In a multicenter Asian study14 designed to evaluate pirenzepine in myopia, the subjects received 2% gel twice daily (gel/gel), 2% gel daily (evening, placebo/gel), or vehicle twice daily (placebo/placebo) in the 2:2:1 ratio, respectively, for 1 year. The main OUTCOME MEASURE, like in most studies, was the spherical equivalent under cycloplegic refraction. At study entry, the mean SE refraction was 2.4+/−0.9 D and at 12 months, there was a mean increase in myopia of 0.47 D, 0.70 D, and 0.84 D in the gel/gel, placebo/gel, and placebo/placebo groups, respectively (p < 0.001 for gel/gel versus placebo/placebo).

There was only a single report of a randomized controlled parallel study of tropicamide, which evaluated 26 pairs of twins.39 This study, which had a follow up period of 3.5 years, found no difference in the myopia outcome when the results of using tropicamide 1% combined with bifocals, against single vision glasses, respectively, were compared.

There were various other drug studies in myopia that employed cycloplegics.13,40,41 These studies, however, suffer from methodological issues such as the lack of a control or randomization.

A study comparing the effect of timolol versus single vision spectacles42 showed no retardation of myopia by timolol. There has been no other controlled trials involving ocular hypotensives in myopia.

In summary, an evidence-based recommendation on the use of atropine in myopia was considered level B (moderately important to outcome).4 Among the various types of pharmacological treatment in myopia, atropine appears to be the most promising. However, some questions remain, for example, what is the optimal dose for childhood myopia? Could the frequency of the administration of atropine be reduced, as an alternative to reducing the concentration of atropine. Currently, concentrations of atropine eyedrops below 1% are not available commercially in most countries. Another issue is the overall duration of treatment. Most clinicians will want to limit the use of atropine to as short a duration as possible. This is because theoretical side effects like increased incidence of light-induced maculopathy and cataracts should not be neglected. Ideally, if one can predict the time course of myopic progression before stabilization, one can limit atropine treatment to this period. In reality, however, it may not be possible to predict with complete certainty the point of stabilization of refractive errors. A study is ongoing in Singapore that aims to evaluate the optimal duration of atropine treatment in myopic children.

351 Atropine and Other Pharmacological Approaches to Prevent Myopia

Other Issues Related to Drugs

Treatment of myopia with bilateral atropine eyedrops has the disadvantage of blurring near vision and so myopic children will require near optical correction for school work and close distance visual activities. A study has evaluated the use of atropine in combination with progressive lens.43 This randomized clinical trial involving 188 subjects showed that 0.5% atropine eyedrops in combination of multifocal glasses was more effective in retarding myopia progression as compared with those wearing multifocal glasses or single vision glasses. The mean progression was 0.41 D per year as compared with 1.19 D and 1.40 D per year, respectively (p < 0.0001).

Traditional Chinese medicine, or even folk medicine and other “holistic” practices and routines have been tested in Asian countries. The only randomized controlled study of this nature retrievable from the PUBMED database was the study that used adhesive pressure plaster of Semen impatientis, a garden balsam seed extract, which claimed significant therapeutic benefit relative to control.44 It is difficult to perform further studies or replicate the results in more studies because the composition of plant extracts is highly complex — they frequently contain unknown active ingredients, and possess variable biological activity between batches. Myopia has become a highly emotive public health issue in some communities. Anecdotally, people have adopted various practices that they perceive as beneficial. It is important, however, for the scientific community to explain that new advances and convincing therapeutics can only be developed and funded if they are supported by peer reviewed scientific evidence.

In the clinical trial conducted in Singapore,19,20 buccal mucosa DNA was collected for genotyping of five published single nucleotide polymorphism (SNP) loci for the human muscarinic receptor-1 gene.45 Polymerase chain reaction (PCR) was performed to amplify a region of the gene containing the SNP of interest (Table 1), followed by restriction enzyme digest to generate DNA bands of differing molecular weight when ran on gel electrophoresis. For this analysis, the subjects who responded to atropine treatment were defined as those with progression of spherical equivalent (cycloplegic autorefraction) of less than 0.5 D during a period of two years. Treatment was deemed to be ineffective when the myopia increased by more than 0.5 D. The chi square test was used to evaluate 2×2 (in the case where two possible alleles exist at the SNP locus) or 2×3 tables (in the case where three possible alleles exist at

352 L.M.G. Tong, V.A. Barathi and R.W. Beuerman

Table 1. Primers used for Polymerase Chain Reaction for Restriction Fragment Length Polymorphism or Sequencing Analyses

 

 

Expected

Annealing

 

 

 

Amplicon

Temperature

Restriction

SNP

Primers

Size (bp)

(°C)

Enzyme

 

 

 

 

 

rs542269

F: TTTGCAAAAGGCCTAACCTG

306

60

BslI

 

R: CCTCTTCCCACAGCACTGTTA

 

 

 

rs2067480

F: CCACCTTCTGCAAGGACTGT

403

62

NlaIV

 

R: CTGGGAATAGCGAAGTCTGG

 

 

 

rs2067477

F: CTGTCAGCCCCAACATCAC

286

65

Cfr13I

 

R: GCCAGCCAGAGGTCACAA

 

 

 

rs2067478

F: TGATCAAGATGCCAATGGTG

241

62

Alu I

 

R: TACGGTGTCCAGGTGAGGAT

 

 

 

rs1065431

F: GCTCTACTGGCGCATCTACC

307

65

MspA1I

 

R: GTCCACCATTGGCATCTTG

 

 

 

rs2075748

F: AGATCCCCCTCAGGAAACTG

295

62

Ban I

 

R: CACCCACCTTGGTTTCTAGC

 

 

 

 

 

 

 

 

SNP: single nucleotide polymorphism.

the SNP locus). One hundred and twenty-two of the subjects with DNA collection had been exposed to atropine eye drops uni-ocularly. Two out of 122 subjects did not have two years of refractive data because of withdrawal from the clinical trial (red eyes causing drug intolerance). When each of the five loci was evaluated one at a time, no particular genotype was associated with the effectiveness of atropine treatment (all p > 0.05). However, one combinatory criterion involving the SNPs rs2067480 and rs542269 was able to discriminate between drug responders and nonresponders (Table 2).

Table 3 shows how the genotypes at rs2067480 and rs542269 were jointly associated with the response to atropine treatment (p = 0.033 by Fishers exact probability test). The odds ratio of responding to the treatment given a positive test on genotyping was 3.40 (95% CI: 1.07–10.82). The test had a reasonably good specificity of 88% (95% CI: 71–96), but sensitivity of only 32% (95% CI: 22–44), with a positive predictive value of 85% (95% CI: 65–95), and a negative predictive value of 37% (95% CI: 27–49). Because of the limited number of subjects in a clinical trial, this data cannot be sufficiently robust to allow multiple testing corrections and evaluation of SNP–SNP interactions, or explore other potentially relevant