- •Contents
- •Foreword
- •Dedication
- •Message
- •About the Editors
- •List of Contributors
- •Acknowledgments
- •Introduction
- •Methodologic Issues
- •Review of Studies (Table 1)
- •Cohort Effects on Myopia
- •Risk Factors for Myopia
- •Near work
- •Education/Income
- •Outdoor activity
- •Race/Ethnicity
- •Nuclear cataract
- •Family aggregation/Genetics
- •Siblings
- •Parent-child
- •Other family members
- •Genetics
- •Comments
- •Acknowledgments
- •References
- •Introduction
- •Definition of Myopia in Epidemiologic Studies
- •Risk Factors for Myopia and Ocular Biometry
- •Family history of myopia
- •Near work
- •Outdoor activity
- •Stature
- •Birth parameters
- •Smoking history
- •Breastfeeding
- •Conclusion
- •References
- •Introduction
- •Aetiological Heterogeneity of Myopia
- •Clearly genetic forms of myopia
- •School or acquired myopia
- •Misunderstandings of Heritability and Twin Studies
- •But Heritability has Its Uses
- •Evidence for Genetic Associations of School Myopia
- •Evidence for the Impact of Environmental Factors on Myopia Phenotypes
- •Gene-Environment Interactions and Ethnicity
- •Gene-Environment Interactions and Parental Myopia
- •Conclusion
- •Acknowledgments
- •References
- •Introduction
- •Economic evaluations
- •Full vs partial evaluations
- •Economic evaluation of myopia
- •The Economic Cost of Myopia: A Burden-of-Disease Study
- •China
- •India
- •Europe
- •Singapore
- •Southeast Asia
- •Africa
- •South America
- •Bangladesh
- •ii. Proportion of myopes paying for correction
- •Uncorrected and undercorrected refractive error, spectacle coverage rate and reasons for spectacles nonwear
- •iii. Amount paid for myopic correction
- •Singapore
- •The burden of myopia
- •Further Directions for Economic Research
- •References
- •Introduction
- •Impact of Myopia in Adults
- •Overall Conclusion
- •Future Studies
- •References
- •Introduction
- •Definition of Pathological Myopia
- •Cataract
- •Glaucoma
- •Myopic Maculopathy
- •Myopic Retinopathy
- •Retinal Detachment
- •Optic Disc Abnormalities
- •References
- •Conclusion
- •Introduction
- •The Association Between Myopia and POAG
- •Information from epidemiological studies
- •Asian populations: Myopia and POAG
- •Myopia in other situations
- •Myopia and ocular hypertension
- •Myopia in angle closure
- •Myopia in Pigment Dispersion Syndrome (PDS)
- •Theories for a Link Between Myopia and POAG
- •Glaucoma Assessment in Myopic Eyes
- •Biometric differences
- •Axial length and CCT
- •Optic disc assessment in myopic eyes
- •Visual fields in myopic eyes
- •Imaging tests and variations with myopia
- •ONH susceptibility to damage
- •The Influence of Myopia on the Clinical Management of the Glaucoma Patient
- •Glaucoma progression and myopia
- •References
- •Posterior Staphyloma
- •Myopic Chorioretinal Atrophy
- •Lacquer Cracks
- •Myopic Choroidal Neovascularization
- •Myopic Foveoschisis
- •Myopic macular hole detachments
- •Lattice degeneration
- •Retinal tears and detachments
- •References
- •Introduction
- •Electroretinography
- •Ganzfeld electroretinography
- •Multifocal electroretinography
- •Assessment of Retinal Function
- •Outer retinal (photoreceptor) function
- •Post-receptoral (bipolar cell) and retinal transmission function
- •Inner retinal function
- •Macular function in myopic retina
- •Effect of Long-Term Atropine Usage on Retinal Function
- •Macular Function Associates with Myopia Progression
- •Factors Associated with ERG Changes in Myopia
- •Conclusion
- •References
- •Introduction
- •Genomic Convergence Using Genomic Content
- •Pathway Analysis
- •Pathway analysis in cancer genomics
- •Pathway analysis in GWAS
- •Non-parametric approaches
- •Parametric approaches
- •P-values combining approaches
- •Conclusion
- •References
- •Introduction
- •Definition of Myopia
- •The Classical Twin Model
- •What is the classical twin model?
- •Historical perspective
- •Statistical approaches
- •Twins, Myopia and Heritability Studies
- •Heritability studies for myopia using twins
- •Limitations of using twins in heritability studies
- •Twins and Myopia — Other Studies
- •The Importance of Twin Registries
- •Concluding Comments
- •Acknowledgments
- •References
- •Introduction
- •Candidate Gene Selection Strategies for Myopia
- •Genes Associated With Myopia-Related Phenotypes
- •The HGF/cMET ligand-receptor axis
- •The collagen family of genes
- •Concluding Remarks
- •Acknowledgments
- •References
- •Introduction
- •Phenotypes for Myopia Genetic Studies
- •Study Design
- •Genotyping and Quality Controls
- •Population Structure
- •Association Tests
- •Correlated Phenotypes
- •Imputation and Meta-Analysis
- •Visualization Tools
- •Drawing Conclusions
- •Acknowledgments
- •References
- •Introduction
- •The Search for Error Signals
- •The blur hypothesis
- •Bidirectional lens-compensation
- •Recovery from ametropia vs. compensation for lenses
- •The complication of the emmetropization end-point
- •Optical aberrations as error signals
- •Other possible visual error signals
- •How Important is Having a Fovea?
- •Mechanisms of Emmetropization
- •Scleral similarities and differences between humans and chickens
- •Retinal signals
- •Glucagon-insulin
- •Retinoic acid
- •Dopamine
- •Acetylcholine
- •Choroidal signals
- •The Role of the Choroid in the Control of Ocular Growth
- •Diurnal rhythms and control of ocular growth
- •Conclusions
- •References
- •Introduction
- •Gross Scleral Anatomy
- •Structural organization of the sclera
- •Cellular content of the sclera
- •Mechanical properties of the sclera
- •Structural Changes to the Sclera in Myopia
- •Development of structural and ultrastructural scleral changes in myopia
- •Scleral pathology and staphyloma
- •Biochemical Changes in the Sclera of Myopic Eyes
- •Structural biochemistry of the sclera in myopia
- •Degradative processes in the sclera of myopic eyes
- •Cellular changes in the sclera in myopia
- •Biomechanical Changes in the Sclera of Myopic Eyes
- •Regulators of scleral myofibroblast differentiation
- •Myofibroblast-extracellular matrix interactions
- •Cellular and matrix contributions to altered scleral biomechanics and myopia
- •Scleral Changes in Myopia are Reversible
- •Eye growth regulation during recovery from induced myopia
- •Summary and Conclusions
- •Acknowledgments
- •References
- •Introduction
- •Spatial Visual Performance and Optical Features of the Eye
- •Axial eye growth and development of refractive state
- •Lens thickness and vitreous chamber depth
- •Corneal radius of curvature
- •Schematic eye data
- •Techniques Currently Available for Myopia Studies in the Mouse, Both for Its Induction and Measurement
- •Devices to induce refractive errors
- •Techniques to measure the induced refractive errors and changes in eye growth
- •Refractive state
- •Corneal radius of curvature
- •Axial length measurements and ocular biometry
- •Measurements of the optical aberrations of the mouse eye
- •Behavioral measurement of grating acuity and contrast sensitivity in the mouse
- •Recent Studies on Myopia in the Mouse Model: Some Examples
- •Magnitudes of experimentally induced refractive errors in wild-type mice
- •Refractive development in mutant mice
- •Pharmacological studies to inhibit axial eye growth in mice
- •Image processing and regulation of retinal genes and proteins
- •Summary
- •Acknowledgments
- •References
- •Introduction
- •A Brief Introduction to Comparative Genomics
- •Comparative Expression
- •Genes in Retina and Sclera in Animal Models of Myopia
- •ZENK (EGR-1)
- •Scleral Gene Expression in a Mouse Model of Myopia
- •RNA, Target cDNA and Microarray Chip Preparation
- •Microarray Data Analysis
- •Scleral Gene Expression in the Myopic Mouse
- •Summary
- •References
- •Introduction
- •Possible Mechanisms of Pharmacological Treatment
- •Efficacy Studies
- •Other Issues Related to Drugs
- •Potential Side Effects
- •The Future of Drug Treatment in Myopia
- •Conclusions
- •References
- •Introduction
- •Accommodation
- •Close work
- •Physical characteristics of the retinal image
- •Visual deprivation
- •Compensatory changes in refraction
- •Intensity and periodicity of light exposure
- •Spatial frequency
- •Light periodicity
- •Image clarity
- •Outdoor activity and retinal image blur
- •Light vergence and photon catch
- •Chromaticity
- •Therapeutic implications
- •References
- •Index
349 Atropine and Other Pharmacological Approaches to Prevent Myopia
myopia development.37 The rationale for the use of ocular hypotensives was that raised intraocular pressure may exert a passive stretching effect on the sclera of the eye, contributing to axial elongation. However, there is little evidence that supports this in the scientific literature.
Efficacy Studies
A parallel group randomized controlled study in Taiwan has shown the efficacy of atropine in the retardation of myopia.16 This study, however, is not masked. Another study in Taiwan has38 evaluated the use of various concentrations of atropine (0.5%, 0.25% and 0.1%) in myopia. A study in Singapore has found 1% atropine to be efficacious in the retardation of childhood myopia.19 Three hundred forty-six (86.5%) children completed the 2-year study. After 2 years, the mean progression of myopia and of axial elongation in the placebo-treated control eyes was −1.20+/−0.69 D and 0.38+/−0.38 mm, respectively. In the atropine-treated eyes, myopia progression was only −0.28+/−0.92 D, whereas the axial length remained essentially unchanged as compared with the baseline (−0.02+/−0.35 mm). The differences in myopia progression and axial elongation between the two groups were −0.92 D (95% confidence interval, −1.10 to −0.77 D; p < 0.001) and 0.40 mm (95% confidence interval, 0.35–0.45 mm; p < 0.001), respectively.
Despite the efficacy results of the studies employing atropine eyedrops, numerous questions remain. One aspect that needs to be addressed is the effect of stopping atropine eye drops. The results of the above study in Singapore show that on stopping atropine after two years of administration, the progression rate of myopia increased in the subsequent year, as compared with children who had placebo in the first two years.20 In the year after cessation of drugs, the mean progression rate in the atropine group was –1.14+/−0.80 D, whereas the placebo group only progressed by –0.38+/− 0.39 D (p < 0.0001). However, a beneficial effect was still evident in the atropine group over the course of three years in the clinical trial. At the end of three years, the spherical equivalent in the atropine group was –4.29+/–1.67 D as compared with –5.22+/−1.38 D in the placebo group (p < 0.0001). Importantly, after the cessation of atropine, the amplitude of accommodation and near visual acuity, previously impaired, returned to pretreatment levels.
350 L.M.G. Tong, V.A. Barathi and R.W. Beuerman
In a multicenter Asian study14 designed to evaluate pirenzepine in myopia, the subjects received 2% gel twice daily (gel/gel), 2% gel daily (evening, placebo/gel), or vehicle twice daily (placebo/placebo) in the 2:2:1 ratio, respectively, for 1 year. The main OUTCOME MEASURE, like in most studies, was the spherical equivalent under cycloplegic refraction. At study entry, the mean SE refraction was −2.4+/−0.9 D and at 12 months, there was a mean increase in myopia of 0.47 D, 0.70 D, and 0.84 D in the gel/gel, placebo/gel, and placebo/placebo groups, respectively (p < 0.001 for gel/gel versus placebo/placebo).
There was only a single report of a randomized controlled parallel study of tropicamide, which evaluated 26 pairs of twins.39 This study, which had a follow up period of 3.5 years, found no difference in the myopia outcome when the results of using tropicamide 1% combined with bifocals, against single vision glasses, respectively, were compared.
There were various other drug studies in myopia that employed cycloplegics.13,40,41 These studies, however, suffer from methodological issues such as the lack of a control or randomization.
A study comparing the effect of timolol versus single vision spectacles42 showed no retardation of myopia by timolol. There has been no other controlled trials involving ocular hypotensives in myopia.
In summary, an evidence-based recommendation on the use of atropine in myopia was considered level B (moderately important to outcome).4 Among the various types of pharmacological treatment in myopia, atropine appears to be the most promising. However, some questions remain, for example, what is the optimal dose for childhood myopia? Could the frequency of the administration of atropine be reduced, as an alternative to reducing the concentration of atropine. Currently, concentrations of atropine eyedrops below 1% are not available commercially in most countries. Another issue is the overall duration of treatment. Most clinicians will want to limit the use of atropine to as short a duration as possible. This is because theoretical side effects like increased incidence of light-induced maculopathy and cataracts should not be neglected. Ideally, if one can predict the time course of myopic progression before stabilization, one can limit atropine treatment to this period. In reality, however, it may not be possible to predict with complete certainty the point of stabilization of refractive errors. A study is ongoing in Singapore that aims to evaluate the optimal duration of atropine treatment in myopic children.
351 Atropine and Other Pharmacological Approaches to Prevent Myopia
Other Issues Related to Drugs
Treatment of myopia with bilateral atropine eyedrops has the disadvantage of blurring near vision and so myopic children will require near optical correction for school work and close distance visual activities. A study has evaluated the use of atropine in combination with progressive lens.43 This randomized clinical trial involving 188 subjects showed that 0.5% atropine eyedrops in combination of multifocal glasses was more effective in retarding myopia progression as compared with those wearing multifocal glasses or single vision glasses. The mean progression was 0.41 D per year as compared with 1.19 D and 1.40 D per year, respectively (p < 0.0001).
Traditional Chinese medicine, or even folk medicine and other “holistic” practices and routines have been tested in Asian countries. The only randomized controlled study of this nature retrievable from the PUBMED database was the study that used adhesive pressure plaster of Semen impatientis, a garden balsam seed extract, which claimed significant therapeutic benefit relative to control.44 It is difficult to perform further studies or replicate the results in more studies because the composition of plant extracts is highly complex — they frequently contain unknown active ingredients, and possess variable biological activity between batches. Myopia has become a highly emotive public health issue in some communities. Anecdotally, people have adopted various practices that they perceive as beneficial. It is important, however, for the scientific community to explain that new advances and convincing therapeutics can only be developed and funded if they are supported by peer reviewed scientific evidence.
In the clinical trial conducted in Singapore,19,20 buccal mucosa DNA was collected for genotyping of five published single nucleotide polymorphism (SNP) loci for the human muscarinic receptor-1 gene.45 Polymerase chain reaction (PCR) was performed to amplify a region of the gene containing the SNP of interest (Table 1), followed by restriction enzyme digest to generate DNA bands of differing molecular weight when ran on gel electrophoresis. For this analysis, the subjects who responded to atropine treatment were defined as those with progression of spherical equivalent (cycloplegic autorefraction) of less than 0.5 D during a period of two years. Treatment was deemed to be ineffective when the myopia increased by more than 0.5 D. The chi square test was used to evaluate 2×2 (in the case where two possible alleles exist at the SNP locus) or 2×3 tables (in the case where three possible alleles exist at
352 L.M.G. Tong, V.A. Barathi and R.W. Beuerman
Table 1. Primers used for Polymerase Chain Reaction for Restriction Fragment Length Polymorphism or Sequencing Analyses
|
|
Expected |
Annealing |
|
|
|
Amplicon |
Temperature |
Restriction |
SNP |
Primers |
Size (bp) |
(°C) |
Enzyme |
|
|
|
|
|
rs542269 |
F: TTTGCAAAAGGCCTAACCTG |
306 |
60 |
BslI |
|
R: CCTCTTCCCACAGCACTGTTA |
|
|
|
rs2067480 |
F: CCACCTTCTGCAAGGACTGT |
403 |
62 |
NlaIV |
|
R: CTGGGAATAGCGAAGTCTGG |
|
|
|
rs2067477 |
F: CTGTCAGCCCCAACATCAC |
286 |
65 |
Cfr13I |
|
R: GCCAGCCAGAGGTCACAA |
|
|
|
rs2067478 |
F: TGATCAAGATGCCAATGGTG |
241 |
62 |
Alu I |
|
R: TACGGTGTCCAGGTGAGGAT |
|
|
|
rs1065431 |
F: GCTCTACTGGCGCATCTACC |
307 |
65 |
MspA1I |
|
R: GTCCACCATTGGCATCTTG |
|
|
|
rs2075748 |
F: AGATCCCCCTCAGGAAACTG |
295 |
62 |
Ban I |
|
R: CACCCACCTTGGTTTCTAGC |
|
|
|
|
|
|
|
|
SNP: single nucleotide polymorphism.
the SNP locus). One hundred and twenty-two of the subjects with DNA collection had been exposed to atropine eye drops uni-ocularly. Two out of 122 subjects did not have two years of refractive data because of withdrawal from the clinical trial (red eyes causing drug intolerance). When each of the five loci was evaluated one at a time, no particular genotype was associated with the effectiveness of atropine treatment (all p > 0.05). However, one combinatory criterion involving the SNPs rs2067480 and rs542269 was able to discriminate between drug responders and nonresponders (Table 2).
Table 3 shows how the genotypes at rs2067480 and rs542269 were jointly associated with the response to atropine treatment (p = 0.033 by Fishers exact probability test). The odds ratio of responding to the treatment given a positive test on genotyping was 3.40 (95% CI: 1.07–10.82). The test had a reasonably good specificity of 88% (95% CI: 71–96), but sensitivity of only 32% (95% CI: 22–44), with a positive predictive value of 85% (95% CI: 65–95), and a negative predictive value of 37% (95% CI: 27–49). Because of the limited number of subjects in a clinical trial, this data cannot be sufficiently robust to allow multiple testing corrections and evaluation of SNP–SNP interactions, or explore other potentially relevant
