1D1 α genome
ctagccggtcacgncgaatgcatctagattccagcccggggnacaggngccatgcagaggaacctgggagctgtgctggggattctgtgggtgcagatttgctgtgagttgtgctaagttcctattagagattctccagaaatgtcggtggtggagggggagaagttgatggaaatctcctgtgcactcttcctcatgggtgtctcctggggtagttgactggtgtgagtgaaaatctctctttgattttggtttgcttttctgttttcaagcaggggtgagcggagataaggtgaaacaaagtccctcagcgctgagtctccaagaaggaaccaattctgctctgagatgcaatttttctatcgccgcgacaactgtgcagtggttcctacagaatcccaggggcagcctcatcaatcttttttacctggttccaggaacaaaggagaatgggaggttaaagtcagcattcgattctaaggagagctacagcaccctgcacatcagggatgcccagctggaggactcaggcacttacttctgtgctgctgatctcatgtctaattacaacgtgctttacttcggatctggcaccaaactcactgtagagccaagtaagttattgttacccacccattatgctaaattcctctactcgctctatatttgctttgagttctctttacttggatccttgtccaatgttgtatca
Рис. 4 Нуклеотидные последовательности геномных ДНК α и β цепей TCR
V район обазначен зеленым
D район обозначен фиолетовым
J район обозначен голубым
N нуклеотиды обозначены коричневым цветом.
Список использованной литературы:
В. Г. Галактионов. Иммунология. М.: изд. «ACADEMA». 2004 г.
Ройт А., Бростофф Дж., Мейтл Д. Иммунология. М. «Мир». 2000 г.
Janeway C. A., Travers P., Walport M., Capra J.D. 1999. Immunobiology. The immune system in health and disease.
Jonathan M. Austyn., Kathryn J. Wood. 1994. Principles of cellular and molecular immunology.
Abul K. Abbas., A. H. Lichtman., J. S. Pober. 1997. Cellular and molecular immunology.
Аnderson MS, Venanzi ES, Klein L, Chen Z, Berzins SP, Turley SJ, von Boehmer H, Bronson R, Dierich A, Benoist C, Mathis D. 2002. Projection of an immunological self shadow within the thymus by the aire protein. Science. Nov 15;298:1395-401.
Goldrath AW, Bevan M. J. 1999. Selecting and maintaining a diverse T-cell repertoire. Nature. Nov 18., 402: 255-262.
Valenzuela J. Schmidt C. Mescher M. 2002. The roles of IL-12 in providing a third signal for clonal expansion of naïve CD8 T cells. The Journal of Immunology. 169: 6842-49.
Germain R. N. 2002. T-cell development and the CD4-CD8 lineage decision. Nature. 2: 309-322
Zerrahn J, Held W, Raulet DH. The MHC reactivity of the T cell repertoire prior to positive and negative selection. Cell, 1997, V. 88(5), P.627-636
Curtsinger JM, Lins DC, Mescher MF.Signal 3 determines tolerance versus full activation of naive CD8 T cells: dissociating proliferation and development of effector function. J Exp Med. 2003 May 5;197(9):1141-51.
Curtsinger JM, Johnson CM, Mescher MF. CD8 T cell clonal expansion and development of effector function require prolonged exposure to antigen, costimulation, and signal 3 cytokine. J Immunol. 2003 Nov 15;171(10):5165-71.
Jones ND, Van Maurik A, Hara M, Spriewald BM, Witzke O, Morris PJ, Wood KJ. CD40-CD40 ligand-independent activation of CD8+ T cells can trigger allograft rejection. J Immunol. 2000 Jul 15;165(2):1111-8.
Grohmann U, Belladonna ML, Bianchi R, Orabona C, Ayroldi E, Fioretti MC, Puccetti P. IL-12 acts directly on DC to promote nuclear localization of NF-kappaB and primes DC for IL-12 production. Immunity. 1998 Sep;9(3):315-23.
Bassing CH, Alt FW, Hughes MM, D'Auteuil M, Wehrly TD, Woodman BB, Gartner F, White JM, Davidson L, Sleckman BP. Recombination signal sequences restrict chromosomal V(D)J recombination beyond the 12/23 rule. Nature. 2000 Jun 1;405(6786):583-6.
Guo J, Hawwari A, Li H, Sun Z, Mahanta SK, Littman DR, Krangel MS, He YW. Regulation of the TCRα repertoire by the survival window of CD4(+)CD8(+) thymocytes. Nat Immunol. 2002 May;3(5):469-76.
Lanzavecchia A. Immunology. Licence to kill. Nature. 1998 Jun 4;393(6684):413-4.
Kouskoff V, Signorelli K, Benoist C, Mathis D. Casset vectors directing expression of T cell receptor genes in transgenic mice. Journal of immunological methods. 1995. Jan 3; 180: 273-280.